Extended-Spectrum-β-Lactamase Producing Multidrug Resistant Klebsiella pneumoniae Isolates from Pediatrics

Sumreen Hayat1,6, Muhammad Hussnain Siddique2, Bilal Aslam1, Habibullah Nadeem2, Asma Ashraf3, Muhammad Saqalein1, Mohsin Khurshid4, Naveed Shahzad5 and Saima Muzammil1,*

1Department of Microbiology, Government College University, Faisalabad

2Department of Bioinformatics and Biotechnology, Government College University, Faisalabad

3Department of Zoology, Government College University, Faisalabad

4College of Allied health Professionals, Directorate of Medical Sciences, Government College University, Faisalabad

5School of Biological Sciences, University of the Punjab, Lahore

6Department of Biotechnology, University of Sargodha, University Road, Sargodha

Sumreen Hayat and M Hussnain Siddique have contributed equally to this article.

ABSTRACT

Klebsiella pneumoniae is mainly responsible for nosocomial and urinary tract infections (UTIs) in pediatric and adult population. The ESBL producing K. pneumoniae present an alarming situation for clinicians by limiting the treatment options. We aimed to determine the antibiotic resistance pattern and characterization of ESBL producing K. pneumoniae isolated from children of different age groups. K. pneumoniae isolated from blood and urine samples were identified through API® 20E kit. Antibiogram was determined by disc diffusion method and isolates were screened for ESBL production using double-disc synergy test (DDST). Molecular detection for the presence of bla-SHV and bla-TEM was carried out by polymerase chain reaction (PCR). Of 392 blood and urine samples, 120 were found positive for microbial growth. Antibiotic susceptibility testing of K. pneumoniae isolates illustrated high resistance to ceftazidime (95.6%). Phenotypically, 52.17% of K. pneumoniae isolates were found to be ESBL producers as observed by double disc synergy test while the tested ESBL genes were detected in 56.52% of isolates. The study revealed multidrug resistance phenotypes among K. pneumoniae isolates with higher prevalence of ESBL producing Klebsiella pneumoniae among the children with urinary tract infections. Based on our findings, it is recommended that the ESBL production should be routinely monitored especially among the K. pneumoniae strains for the effective management and control of such MDR pathogens.

Article Information

Received 22 December 2018

Revised 03 February 2019

Accepted 21 February 2019

Available online 30 April 2019

Authors’ Contribution

SH and MHS performed the experiments and wrote the manuscript. MS and MK designed the study. AA analysed the data. BA and HN helped in samples collection. SM supervised the work and reviewed the manuscript.

Key words

UTIs, Klebsiella pneumoniae, Double disc synergy test, ESBL, Antibiotic resistance.

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.4.1251.1257

* Corresponding author: saimamuzammil83@gmail.com

0030-9923/2019/0004-1251 $ 9.00/0

Copyright 2019 Zoological Society of Pakistan

Introduction

Urinary tract infections (UTIs) are one of the most common infections among pediatrics, with an annual prevalence of 0.7 % per person and also being responsible for more than $180 million spent per year for treatment purposes (Ranjbar et al., 2017). Generally, initial antibiotic treatment is empirically supported until the availability of culture and drug sensitivity results. However, over-reliance on antibiotics to cope with bacteria and their irrational use lead to the emergence of resistance among these pathogens. Indiscriminate use of antibiotics in humans is widely discussed and considered as a primary cause of bacterial resistance development (Hawser et al., 2011).

Among Enterobacteriaceae family, especially E. coli and Klebsiella spp. are responsible for Urinary tract infections (UTIs) exhibiting higher degree of resistance to antibiotics used for the treatment and situation is becoming worse in developing countries including Pakistan. The resistance is mainly due to plasmid-encoded enzymes called extended spectrum β-Lactamases (ESBLs) (Livermore, 2008). ESBLs exhibit resistance not only to β-lactam antibiotics, but also sometimes, responsible for cross-resistance towards other antibiotics such as quinolones, trimethoprim-sulfamethoxazole (TMP-SMX), and aminoglycosides (Coque et al., 2008; Akhtar et al., 2018). The most common types of ESBLs include SHV, TEM, and CTX-M. Other clinically significant types include BEL-1, PER, VEB, PER, SFO-1, BES-1 and IBC (Livermore, 2008).

Multidrug resistant (MDR) Klebsiella species especially K. pneumoniae infection is spreading worldwide (Coque et al., 2008). K. pneumoniae is an opportunistic pathogen associated with various infections in humans such as urinary tract infections (UTIs), septicemia, pneumonia, wound infections and infections associated with intensive care units (I.C.U) (Dhillon and Clarck, 2012). Moreover, there are multiple reports describing association of Klebsiella pneumoniae with hospital acquired infections, especially sepsis (Afridi et al., 2011). K. pneumoniae is detected in 40% UTI patients, thus making it the second most prevalent pathogen followed by E. coli (Mythri et al., 2014).

Although, there are a few studies from Pakistan indicating the incidence of ESBL producing Klebsiella pneumoniae responsible for UTIs (Batool et al., 2016; Kausar et al., 2014) but information regarding the occurrence among children particularly in Southern areas of Punjab, is limited. Therefore, the current study was designed to elucidate the status of ESBLs producing MDR Klebsiella pneumoniae and their antibiotic susceptibility pattern among children of different ages. Blood and urine samples from UTI patients belonging to District Multan, Punjab, Pakistan were collected due to the lack of availability of data from this region.

 

Materials and methods

Isolation and identification of bacteria

A total number of 392 samples (Urine = 197 and Blood = 195 while two of the patients refused to give blood samples) were aseptically collected during March 2018 to June 2018, from 197 patients with urinary tract infections (UTIs) in Nephrology and Urology wards of Children Hospital Complex and Nishtar Hospital from Multan, Punjab, Pakistan. Only the admitted patients were included in the study and sampling was done by non-probability convenient sampling method, and all the subjects were grouped based on demographic features such as gender and age (< 5 years, between 5-10 years and > 10 years). Blood specimens (1-3 mL) were primarily inoculated in BD BACTEC™ Peds Plus™ medium culture vials (BD™, USA) and monitored for bacterial growth for a period of 5-7 days. The culture positive bottles were streaked onto non-selective media i.e., nutrient agar (Oxoid™, UK) followed by Gram staining (Batool et al., 2016). Later, selected colonies were streaked onto Blood agar (Oxoid™, UK) and MacConkey agar (Oxoid™, UK) media as well. Whereas urine specimens were cultured on CLED (BD™, USA) agar and incubated for 24-48 h at 37°C. The isolates were identified by various biochemical tests and finally confirmed by multi-test identification systems i.e. API® (Biomerieux™, France).

Antibiotic susceptibility testing

Antibiotic susceptibility testing of K. pneumoniae isolates was carried out by using disc diffusion method according to the guidelines of Clinical and Laboratory Standards (CLSI, 2015). Following antibiotic discs were used for susceptibility profiling: ceftazidime (30μg), c iprofloxacin (5μg), Amikacin (30μg), piperacillin-tazobactam (100/10μg), meropenem (10μg) and chloramphenicol (30μg). The interpretation of susceptibility results was done according to the guidelines of Clinical Laboratory Standards Institute (2015) (Kausar et at., 2014). Organisms exhibiting intermediate or resistant in at least 3 of above classes of antibiotics were multidrug resistance (MDR).

Screening of ESBL producers

K. pneumoniae isolates were screened for their ESBLs production by double-disc diffusion/synergy test (DDST); a phenotypic identification method for ESBL positive K. pneumoniae. Ceftazidime (30μg) with and without clavulanic acid (10 μg) (Oxoid™, UK) were used for phenotypic detection and interpretation of ESBL production according to the methodology published in Clinical and Laboratory Standard Institute guidelines (CLSI, 2015).

Etraction of plasmid DNA and PCR amplification

Plasmid DNA was extracted from each isolate (detected phenotypically as ESBLs producers) using QIAGEN® Plasmid Mini Kit (QIAGEN®, USA). PCR amplification was carried out for beta-lactamase genes of the family SHV and TEM using following pairs of primers: 5’ ATGCGTTATATTCGCCTGTG 3’ and 5’ AGATAAATCACCACAATGCGC 3’ for blaSHV and 5’ AAAATTCTTGAAGACG 3’ and 5’ TTACCAATGCTTAATCA 3’ for blaTEM (Macrogen™, Korea). The PCR conditions used for blaSHV were initial denaturation at 95oC for 5 min followed by 35 cycles at denaturation: 95oC for 30 sec, annealing: 56oC for 30 sec, amplification: 72oC for 2 min and final extension at 72oC for 10 min (Du et al., 2014). For the amplification of blaTEM, PCR conditions comprised initial denaturation: 94oC for 3 min followed by 35 cycles at denaturation: 94oC for 30 sec, annealing: 50oC for 30 sec, amplification: 72oC for 2 min and final extension at 72oC for 10 min (Sharma et al., 2010). Following gel electrophoresis, PCR product was visualized under UV transilluminator after staining with ethidium bromide. The product size was 896bp and 980bp for blaSHV and for blaTEM, respectively.

 

Results

Out of 392 blood and urine specimens of children (different age groups) collected from Children Hospital Complex and Nishtar Hospital Multan, Punjab, Pakistan. 120 samples were positive for microbial growth, whereas remaining samples did not depict any visible growth. It was observed that frequency of positive cultures (blood and urine specimens) was 30.61%. Of 120 positive cultures, 107 were Gram-negative rods (GNRs), 9 were Gram-positive cocci and 4 were fungal cultures as shown (Table I).

 

Table I.- Frequency distribution of different microorganisms from UTIs patients (n= 120).

Organisms	Frequency	Percentage
Gram negative rods (GNRs)	107	89.16%
Gram positive cocci (GPC)	9	7.5%
Fungi	4	3.33%

 

Table II.- Frequency distribution of various isolates from UTIs patients.

Organisms	Frequency	Percentage
Gram negative rods (n= 107)
K. pneumoniae	46	43%
E. coli	52	48.6%
Pseudomonas spp.	6	5.6%
Proteus spp.	3	2.8%
Gram positive cocci (n= 9)
Staphylococcus spp.	5	55.55%
Streptococcus spp.	4	44.44%

 

It was also noticed that 29.44% urine (n=197) and 25.13% blood (n=195) samples were positive for GNRs. Thus, relatively high frequency of GNRs was found in urine (58/197) as compared to blood samples (49/195). Among the Gram-negative isolates, E. coli was the predominant one (48.6%) followed by K. pneumoniae (43%) as indicated in Table II the frequency of various isolates from urine and blood specimens of patients.

Our data had indicated that prevalence of GNRs isolated from urine and blood specimens was relatively high among females (52.33%) as compared to males (47.67%). While group wise distribution had indicated that the highest frequency of GNRs was found among children of age group <5 years (41.12%) followed by age group of >10 years (33.65%) as shown in Table III.

Antibiotic susceptibility pattern of K. pneumoniae isolates against routinely used antibiotics had indicated that 71.7% isolates were resistant to amikacin, 67.4% against ciprofloxacin, and 95.6% to ceftazidime. Majority of Klebsiella isolates exhibited multidrug resistance against routinely used antibiotics, while only 10.8 % and 6.5% of isolates exhibited resistance to piperacillin-tazobactam and meropenem, respectively. In the present study, phenotypic detection of ESBL production by double disc synergy test indicated that a high frequency (52.17%) of clinical isolates of K. pneumoniae was ESBL producers whereas 47.83% of K. pneumoniae were non-ESBL producers (Table IV).

 

Table III.- Gender and age wise distribution of GNRs isolated from urine and blood samples of UTIs patients.

Targeted population	Frequency	Percentage
Males	51	47.67%
Females	56	52.33%
<5 years	44	41.12%
5-10 years	27	25.23%
>10 years	36	33.65%

 

Table IV.- Molecular detection of percentage occurrence of beta lactamase genes (bla-SHV and bla-TEM) in K. pneumoniae isolates.

K. pneumoniae isolates (n=46)	Beta lactamase genes detection
	SHV (%)	TEM (%)	SHV/TEM (%)
Phenotypic ESBL producers (n=24) (52.17%)	21 (87.5)	19 (79.16)	17 (70.83)
Phenotypic non ESBL producers (n=22) (47.83%)	5 (22.72)	4 (18.18)	4 (18.18)
Total ESBL producers	56.52%

 

Molecular detection of ESBL genes was also carried out for bla-SHV and bla-TEM genes using plasmid DNA extracted from K. pneumoniae isolates. The 1080 bp PCR products of TEM and 896 bp PCR products of SHV genes were amplified as shown in Figure 1. The results indicated that 56.52% of ESBL producers among K. pneumoniae isolates carried either SHV or TEM genes. 21 out of 24 isolates were positive for SHV gene while 19 isolates carried TEM gene. Interestingly, 5 out of 22 isolates (confirmed as non-ESBL producers phenotypically) were also positive for having SHV gene and 4 out of these were also positive for TEM as shown in Table IV.

 

Discussion

Urinary tract infections (UTIs) are the most common among all nosocomial infections especially in children and multi drug resistant ESBLs producing K. pneumoniae plays significant role. In the current study, overall 30.61% samples (urine and blood, n=392) yielded microbial growth and this figure correlates with the earlier reports (Ahmad, 2013; Jamil et al., 2014) Furthermore 29.44% urine (n=197) and 25.13% blood (n=195) samples were positive for GNRs. But according to available data 9 to 34% positivity of urine (Jahanzeb et al., 2008; Oh et al., 2013) and about 20 to 50% positivity of blood specimens had been reported in preceding studies (Lee et al., 2012; Livermore, 2008). The disparity in results could be due to the differences in sample size and sample processing technique (Jamil et al., 2014). In present investigation, GNRs were recorded 89.16%, 7.5% GPC and 3.33% fungi. The number of GNRs was comparable with the previous data from Pakistan (91%), Turkey (89%), Iran (90.3%) and Australia (96%) (Ayazi et al., 2010; McMullan et al., 2007; Tumbarello et al., 2006). The frequency of GNRs isolated from urine specimens was relatively high (29.44%) in contrast to blood (25.13%), it is coherent with a previous report suggesting that the most common clinical sample to yield the GNRs was urine (McMullan et al., 2007). However, bacteremic infections caused by Enterobacteriaceae members has witnessed increasing trend around the globe (Tumbarello et al., 2008).

According to our results E. coli was the predominant one (48.6%) followed by K. pneumoniae (43%), Pseudomonas spp. (5.6%) and Proteus spp. (2.80%), the findings with respect to the range of Gram negative urinary tract pathogens are in line with the previously published data (Manisha et al., 2012; Sohail et al., 2015). Urinary tract infections mostly result from GNRs (80 to 85%) and E. coli plays major role (75 to 95%) followed by Klebsiella pneumoniae and a few cases develop due to GPC as well (Manisha et al., 2012). It is an established fact that members of Enterobacteriaceae family are the leading culprits for UTIs. As these microbes reside in human gut as normal flora, so can easily infect the persons suffering from other diseases and with poor hygiene during their stay at hospital (Sohail et al., 2015). E. coli is still by far the most frequent pathogen among all uropathogens (Ghafourian et al., 2012; Shaikh et al., 2015). But in contrast to our results a few reports from the recent past had pointed out that K. pneumoniae was the most prevalent UTI pathogen (Ahmad, 2013; Garg et al., 2007).

In the present study, total of 46 K. pneumoniae isolates were confirmed, out of which 52.17% (24/46) were declared positive for ESBLs production and 47.83% (22/46) as non-ESBLs producers. In current study, urinary tract was the hub of ESBL producing K. pneumoniae infections 58.33% (14/24) followed by bacteremia 41.67% (10/24), which resembles with other investigations suggesting K. pneumoniae to be culpable for 6-17% of nosocomial UTIs and 4 to 15% of bacteremic infections (Ghafourian et al., 2012). Concerning the resistance patterns of K. pneumoniae the study showed that resistance percentage of ceftazidime (95.6%) was highest. Antibiotic resistance was reported for K. pneumoniae from blood and UTI isolates in Lahore (Mythri et al., 2014). Resistance to certain antibiotics is well known phenomenon for K. pneumoniae, which are acquired by resistance genes like ESBLs. K. pneumoniae isolates were divided into two groups: (i) ESBLs producing and (II) non-EBSLs producing. The frequency of ESBLs producing K. pneumoniae in present study was comparable to a study from India and Iran (Sharma et al., 2008; Ayazi et al., 2010; Mohajeri et al., 2018). The frequency of EBSLs producing K. pneumoniae is high as compare to other reported studies in Pakistan. ESBLs prevalence in the clinical isolates varies worldwide and in different geographical areas and rapidly change over time. This high frequency may be due to poor hygienic conditions in Multan as compared to other cities in Pakistan such as Lahore, or may be because of lack of facilities and knowledge about health a mong peoples. While we found the difference of values between phenotypic screening by double disc synergy test and molecular detection of ESBLs producing genes as in the case with Sharma et al. (2008). Phenotypic tests for detection of ESBL could not be hundred percent reliable as may be ESBLs production could not reach to detectable level by disc diffusion test. This situation can create problem for clinical researcher. These phenotypic tests need to be evaluated regularly as new enzymes or mutations in the genes may change the performance of these tests (Ghafourian et al., 2012). In our study, 3 out of 24 ESBLs producing K. pneumoniae isolates could not be detected at molecular level for blaSHV and blaTEM. It might be due to the involvement of some other genes in ESBL production such as CTX-M or other subtypes of SHV or TEM. Although molecular detection is more sensitive, reliable and definitive for ESBL subtype detection but it is expensive and requires specialized expertise (Burgess et al., 2003). Furthermore, it is not possible in developing countries due to facilities constraint.

Treatment of ESBL-producing K. pneumoniae is difficult because of its resistance to multiple antibiotics. Carbapenems has been experienced to cure the infection caused by ESBL-producing microorganisms (Shiri et al., 2017). A set of antibiotics used in clinical infections were selected for antibiotic susceptibility. Our results reported the most effective and least effective antibiotic against K. pneumoniae. Current study provides an insight about the frequency distribution of ESBLs producing K. pneumoniae that will help clinicians in selection of antibiotics for the treatment of K. pneumoniae infections.

 

Conclusions

In our study, it was observed that the most effective drug against clinical isolates of K. pneumoniae was meropenem along with piperacillin-tazobactam exhibiting resistance of 6.5% and 10.8%, respectively. The present study warrants the empirical use of meropenem for the therapeutic management of infections caused by ESBL producing bacterial pathogens, however, a large multicenter study involving molecular tools should be performed to assess the exact magnitude of the problem due to ESBL producing pathogens among children.

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Afridi, F.I., Farooqi, B.J. and Hussain, A., 2011. Frequency of extended spectrum beta lactamase producing enterobacteriaceae among urinary pathogen isolates. J. Coll. Physic. Surg. Pak., 2112: 741-744.

Ahmad, S., 2013. Pattern of urinary tract infection in Kashmir and antimicrobial susceptibility. Bangladesh. Med. Res. Counc. Bull., 38: 79-83. https://doi.org/10.3329/bmrcb.v38i3.14330

Akhtar, J., Saleem, S., Shahzad, N., Waheed, A., Jameel, I., Rasheed, F. and Jahan, S., 2018. Prevalence of Metallo-β-Lactamase IMP and VIM producing gram negative bacteria in different hospitals of Lahore, Pakistan. Pakistan J. Zool., 50: 2343-2349.

Al-Momani, T., 2006. Microbiological study of urinary tract infection in children at Princess Haya Hospital in south of Jordan. Middle East. J. Family Med., 3: 2.

Ayazi, P., Mahyar, A., Jahani, H.H. and Khabiri, S., 2010. Urinary tract infections in children. Iran J. Pediatr. Soc., 2. 9-14.

Bajpai, T., Pandey, M., Varma, M. and Bhatambare, G.S., 2017. Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J. Med., 7: 12-16. https://doi.org/10.4103/2231-0770.197508

Batool, A., Baig, H. and Qamar, M.U., 2016. Extended spectrum-β-lactamase producing Escherichia coli and Klebsiella pneumoniae causing urinary tract infection. Afr. J. Microbiol. Res., 10: 1775-1778. https://doi.org/10.5897/AJMR2015.7895

Burgess, D.S., Hall, R.G., Lewis, J.S., Jorgensen, J.H. and Patterson, J.E., 2003. Clinical and microbiologic analysis of a hospital’s extended-spectrum β-lactamase-producing isolates over a 2-year period. Pharmacotherapy, 23: 1232-1237. https://doi.org/10.1592/phco.23.12.1232.32706

CLSI, 2015. Performance standards for antimicrobial susceptibility Testingma. Twenty-Fifth Informational Supplement, CLSI document M100-S25, Clinical and Laboratory Standards Institute, 950 West Valley Road, Suite 2500, Wayne, Pennsylvania 19087 USA,

Coque, T.M., Baquero, F. and Canton, R., 2008.Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. Euro Surveill., 13: 48.

Dhillon, R.H.P. and Clark, J., 2012. ESBLs: A clear and present danger? Crit. Care Res. Pract., 2012: Article ID 625170. https://doi.org/10.1155/2012/625170

Du, J., Li, P., Liu, H., Lu, D., Liang, H. and Dou, Y., 2014. Phenotypic and molecular characterization of multidrug resistant Klebsiella pneumoniae isolated from a University Teaching Hospital, China. PLoS One, 9: e95181. https://doi.org/10.1371/journal.pone.0095181

Ejaz, H., Zafar, A., Anwar, N., Cheema, T. and Shehzad, H., 2006. Prevalence of bacteria in urinary tract infections among children. Biomedica, 22: 139-142.

Garg, A., Anupurba, S., Garg, J., Goyal, R.K. and Sen, M.R., 2007. Bacteriological profile and antimicrobial resistance of blood culture isolates from a University Hospital. J. Indian Acad. clin. Med., 8: 139-143.

Ghafourian, S., Sekawi, Z., Neela, V., Khosravi, S., Rahbar, M. and Sadeghifard, N., 2012. Incidence of extendedspectrum beta-lactamase-producing Klebsiella pneumoniae in patients with urinary tract infection. Sao Paulo med. J., 130: 37-43. https://doi.org/10.1590/S1516-31802012000100007

Hawser, S.P., Bouchillon, S.K. and Lascols, C., 2011. Susceptibility of Klebsiella pneumoniae isolates from intra-abdominal infections and molecular characterization of ertapenem-resistant isolates. Antimicrob. Agents Chemother., 55: 3917-3921. https://doi.org/10.1128/AAC.00070-11

Jahanzeb, M., Siddiqui, T. and Idris, M., 2008. Frequency and clinical presentation of UTI among children of Hazara Division, Pakistan. J. Ayub med. Coll. Abbottabad, 20: 63.

Jamil, I., Zafar, A., Qamar, M.U., Ejaz, H., Akhtar, J. and Waheed, A., 2014. Multi-drug resistant Klebsiella pneumoniae causing urinary tract infections in children in Pakistan. Afr. J. Microbiol. Res., 8: 316-319. https://doi.org/10.5897/AJMR2013.6409

Kausar, A., Akram, M. and Shoaib, M., 2014. Isolation and identification of UTI causing agents and frequency of ESBL (extended spectrum beta lactamase) in Pakistan. Am. J. Phytomed. clin. Ther., 2: 963-975.

Kumarasamy, K.K., Toleman, M.A. and Walsh, T.R., 2010. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: A molecular, biological, and epidemiological study. Lancet Infect. Dis., 10: 597-602. https://doi.org/10.1016/S1473-3099(10)70143-2

Latifpour, M., Gholipour, A. and Damavandi, M.S., 2016. Prevalence of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolates in nosocomial and community-acquired urinary tract infections. Jundishapur J. Microbiol., 9: e31179. https://doi.org/10.5812/jjm.31179

Lee, N.Y., Lee, C.C., Huang, W.H., Tsui, K.C., Hsueh, P.R. and Ko, W.C., 2012. Carbapenem therapy for bacteremia due to extended-spectrum-β-lactamase-producing Escherichia coli or Klebsiella pneumoniae implications of ertapenem susceptibility. Antimicrob. Agents Chemother., 56: 2888-2893. https://doi.org/10.1128/AAC.06301-11

Livermore, D.M., 2008. Defining an extended-spectrum beta-lactamase. Clin. Microbiol. Infect., 14: 3-10. https://doi.org/10.1111/j.1469-0691.2007.01857.x

Manisha, N.S. and Pratibha, B.D., 2012. Emergence of multi-drug-resistant Klebsiella pneumoniae in Neonatal Intensive Care Units: Concern about antimicrobial policies. Res. J. Rec. Sci., 1: 275-280.

McArthur, A.G., Waglechner, N. and Nizam, F., 2013. The comprehensive antibiotic resistant database. Antimicrob. Agents Chemother., 57: 3348-3357. https://doi.org/10.1128/AAC.00419-13

McMullan, R., Loughrey, A.C., McCalmont, M. and Rooney, P.J., 2007. Clinicoepidemiological features of infections caused by CTX-M type extended spectrum beta lactamase-producing Escherichia coli in hospitalised patients. J. Infect., 54: 46-52. https://doi.org/10.1016/j.jinf.2006.01.004

Mohajeri, P., Kavosi, S., Esmailzadeh, T., Farahani, A. and Dastrani, M., 2018. Molecular characterics of extended spectrum beta lactamase producing Klebsiella pneumoniae isolates in the West of Iran. Adv. Hum. Biol., 8: 175-179. https://doi.org/10.4103/AIHB.AIHB_20_18

Mythri, H. and Kashinath, K.R., 2014. Nosocomial infections in patients admitted in Intensive Care Unit of a Tertiary Health Center, India. Annls. Med. Hlth. Sci. Res., 4: 738-741. https://doi.org/10.4103/2141-9248.141540

Oh, E., Lee, H., Lim, H.S. and Park, Y., 2013. Epidemiology and resistance patterns of bacterial pathogens in urinary tract infections in the Northern Gyeonggido area during 2007-2011. Lab. Med. Online, 3: 34-39. https://doi.org/10.3343/lmo.2013.3.1.34

Peleg, A.Y. and Hooper, D.C., 2010. Hospital-acquired infections due to gram negative bacteria. N. Engl. J. Med., 362: 1804-1813. https://doi.org/10.1056/NEJMra0904124

Ranjbar, R., Memariani, H. and Sorouri, R., 2017. Molecular epidemiology of extended-spectrum beta-lactamase-producing Klebsiella pneumonia strains isolated from children with urinary tract infections. Arch. Pediatr. Infect. Dis., 5: e39000.

Shaikh, S., Fatima, J., Shakil, S., Rizvi, S.M. and Kamal, M.A., 2015. Risk factors for acquisition of extended spectrum beta lactamase producing Escherichia coli and Klebsiella pneumoniae in North-Indian hospitals. Saudi J. biol. Sci., 22: 37-41. https://doi.org/10.1016/j.sjbs.2014.05.006

Sharma, M., Yadav, A., Yadav, S., Goel, N. and Chaudhary, U., 2008. Microbial profile of septicemia in children. Ind. J. Pract. Doc., 5: 9-10.

Sharma, J., Sharma, M. and Ray, P., 2010. Detection of TEM & SHV genes in Escherichia coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. Indian J. med. Res., 132: 332-336.

Shiri, N.V., Kira, K. and Alessandra, C., 2017. Klebsiella pneumoniae: A major worldwide source and shuttle for antibiotic resistance. FEMS Microbiol. Rev., 41: 252-275. https://doi.org/10.1093/femsre/fux013

Sohail, M., Khurshid, M., Saleem, H.G.M., Javed, H. and Khan, A.A., 2015. Characteristics and antibiotic resistance of urinary tract pathogens isolated From Punjab, Pakistan Jundishapur J. Microbiol., 8: e19272. https://doi.org/10.5812/jjm.19272v2

Tanvir, R., Hafeez, R. and Hussain, S., 2012. Prevalence of multi drug resistant E. coli in patients of UTI registering at a diagnostic Laboratory in Lahore, Pakistan. Pakistan J. Zool., 44: 707-712.

Tumbarello, M., Spanu, T. and Sanguinetti, M., 2006. Bloodstream infections caused by extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae: Risk factors, molecular epidemiology, and clinical outcome. Antimicrob. Agents Chemother., 50: 498-504. https://doi.org/10.1128/AAC.50.2.498-504.2006

Varkey, D.R., Balaji, V. and Abraham, J., 2014. Molecular characterisation of extended spectrum Beta lactamase producing strains from blood sample. Int. J. Pharm. Sci., 6: 276-278.