The mRNA Expression of Host Defense Peptides in Chicken Erythrocytes are Highly Related to Tibial Dyschondroplasia and Induced by Recombinant Glutathione-S-Transferase A3 Protein

Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*

1College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu 030801, China

2Taiyuan Center for Disease Control and Prevention, Taiyuan 030024, China

3State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China

ABSTRACT

Chicken erythrocyte, which is the most abundant cell subset in blood vessel, also exists in cartilage zone. It has recently been shown that chicken erythrocytes constitutively express toll-like receptors (TLRs), cytokines, and avian β-defensins (AvBDs). Host defense peptides (HDPs) are important effector molecules in innate immunity. In this study, thiram has been used to induce tibial dyschondroplasia (TD) and the chickens were injected with different doses of recombinant glutathione-S-transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were suppressed by thiram-induced TD, and the expressions of HDPs were upregulated by rGSTA3 protein. These findings demonstrated that mRNA expressions of HDPs are highly related to thiram-induced TD, and rGSTA3 protein enhanced the immune response of chicken erythrocytes by up-regulating HDPs expression. Future studies may be aimed at elucidating the association between the expression of these peptides and the development of the TD.

Article Information

Received 29 October 2018

Revised 11 December 2018

Accepted 20 December 2018

Available online 15 May 2019

Authors’ Contribution

SN drafted the basic manuscript and analyzed the data. WXT and HCC contributed to conception and design of the research and reviewed the manuscript. ARJ, FJJ, XL, GBN, DZ, HLM and WFH participated in sample collection and laboratory testing. WWG, YJZ, SMG, GLL, JHL, FY and RKG participated in the data analysis and revising the manuscript.

Key words

Chicken, Erythrocyte, Glutathione-S-transferase A3, Host defense peptide, Tibial dyschondroplasia.

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.4.1475.1482

* Corresponding author: wenxiatian@126.com

0030-9923/2019/0004-1475 $ 9.00/0

Copyright 2019 Zoological Society of Pakistan

Introduction

Tibial dyschondroplasia (TD) is a common group-occurring avian skeletal disease that is characterized by the accumulation of avascular cartilage in the metaphysis and can lead to varying degrees of lameness. For research purpose, thiram has been used to induce TD with high regularity and precision for young broiler chicks (Rath et al., 2007). By using thiram-induced model, some studies showed that vascularization had an important role in bone repair and pathology including TD, fracture healing, and rickets, etc. (Gay et al., 2007; Lee et al., 2012; Street et al., 2002; Zhang et al., 2013). The focus of early research was on the involvement of immune responses in bone diseases including TD (Nagahama et al., 2004; Philippart et al., 1993). For example, some research data indicated that low levels of several interleukins and macrophage expression of Galectin-3 (formerly called MAC-2 antigen) were detected during the development of bone lesions, and then returned to normal value after healing (Philippart et al., 1993). Moreover, other data showed that the deficiency of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) or programmed death-1 (PD-1), which can be induced on activated T cells, reduced osteoclastogenesis resulting in an osteopetrotic phenotype (Nagahama et al., 2004; Nabi et al., 2018).

In avian species, three main host defense peptides (HDPs) including avian β-defensins (AvBDs), cathelicidins (CATHs) and liver-expressed antimicrobial peptide-2 (LEAP-2) are important effector molecules in innate immunity and can kill various pathogenic broad-spectrum microorganisms (Butler et al., 2016; Cuperus et al., 2013; Van Dijk et al., 2008). Chicken erythrocyte, which is the most abundant cell subset in blood vessel, also exists in cartilage zone. Our group recently reported that the transcripts of eight AvBDs and LEAP-2 were found in chicken erythrocytes and they participated in MDV-induced host immune response (Niu et al., 2018). The transcripts of some types of toll-like receptors (TLRs) and cytokines were also detected recently in erythrocytes (St Paul et al., 2013). In addition, it has been shown HDPs are not confined to directly inhibit pathogen and can also control LPS-induced effects and promote phagocytosis, DNA uptake and wound healing (Cuperus et al., 2013; Semple et al., 2012; Zanetti, 2005). However, the biological role of the HDPs of chicken erythrocytes in TD has still not been explored.

Glutathione-S-transferases (GSTs), the main antidotal enzymes, have an important role in toxicology on account of its function that GSTs can catalyze the conjugation of nucleophilic GSH to various exogenous compounds (Townsend et al., 2003). Our study has previously identified that GSTA3 transcript was differentially expressed in chondrocytes after thiram-induced TD (Tian et al., 2013). GSTs also participate in the biosynthesis of classical PGs which can regulate chondrocyte differentiation and matrix synthesis (Chang et al., 1987; Li et al., 2004; O’Keefe et al., 1992). Acute cytotoxicity and genotoxic effects of aflatoxin B1 (AFB1) were reported to be more sensitive to GSTA3 knockout mice than the similarly treated wild-type mice (Ilic et al., 2010). These researches revealed that the rGSTA3 protein may have a potential role in the alleviation of TD.

In the occurrence of TD, a mass of nonviable cells has been produced in the cartilage, therefore, these cells must be removed before normal cartilage is restored. It has been recently shown that the tibial vascular distribution was suppressed after thiram-induced TD, and the levels of total RBC (red blood cell), HCT (hematocrit) and Hb (hemoglobin) were significantly reduced in the initial stage of TD (Huang et al., 2017). It has also been reported that vascularity within the developing growth plate can alleviate the clinical signs of TD (Street et al., 2002). These findings raise the possibility that immune responses of chicken erythrocytes also contribute to the prevention and treatment of TD. The objective of this study is to explore the effects of rGSTA3 protein and thiram-induced TD on the mRNA expression of HDPs in erythrocytes.

 

Materials and Methods

Ethics statement

The management of the experimental animals was in agreement with the welfare guidelines approved by the College of Animal Science and Veterinary Medicine of Shanxi Agricultural University, China (Number 88, 2010). Before exsanguination and necropsy, injection of pentobarbital was used along with the standard protocols of euthanasia to minimize animals suffering.

Animals and reagents

One-day-old broiler chickens (n = 120) were bought from Shanxi Daxiang Farming Group (Shanxi, China) and raised in battery brooders, under a light regimen of 14 h light:10 h dark. A diet appropriate for their age was provided ad libitum. Thiram (JL131223002) was purchased from American Research Product (Massachusetts, USA); rGSTA3 protein was provided by College of Animal Science and Veterinary Medicine of Shanxi Agricultural University (Shanxi, China).

Induction of TD and rGSTA3 protein injection

From 1-day-old to 7-day-old chickens were fed a basal diet purchased from Shanxi Daxiang Farming Group (Shanxi, China). On days chickens were divided randomly into 6 groups (groups A–F, 20 chicks/group). Groups A, B and C were the basal diet groups, and groups D, E and F were the thiram-fed groups. Starting from day 8, the thiram-fed groups (D, E and F) were fed a diet containing 100 mg/kg of thiram for 2 days to induce TD, and then the chickens in all 6 groups were fed basal diet. On day 8, 10, 12, and 14, 4 treatment groups (B, C, E, F) were injected rGSTA3 proteins at a dosage of 20 μg/kg (groups B and E) and 50 μg/kg (groups C and F) 4 times, as previously described (Wang et al., 2018). On day 12 and 23, the blood samples were collected.

Blood collection and erythrocyte isolation

Blood samples were drawn from wing vein (2 mL per bird) and collected into anticoagulant tubes, and then diluted at 1:1 in Alsever’s solution. The diluted blood was overlaid onto Histopaque solution (Histopaque-1119; Sigma-Aldrich, USA) and then centrifuged at 500g for 20 min. Subsequently, the platelets and leukocytes-containing supernatant were removed as previously described (St Paul et al., 2013). Erythrocytes isolated were determined to be > 99.9% pure by Wright–Giemsa staining.

RNA extraction and cDNA synthesis

Total RNA was purified from erythrocytes isolated from blood samples by using RNAiso Plus (Takara Bio Inc., Dalian, China) according to an improved method and then dissolved in 20 μL DEPC-treated water. The preliminary quantity and purity of the extracted RNA was measured by a NanoDropBioanalyzer ND1000 (Labtech, Uckfield, UK) and RNA integrity was verified by 1.5% agarose gel electrophoresis. Total RNA (500 ng) was reverse transcribed to cDNA using the reverse transcription kit (PrimeScript RT reagent Kit; Takara Bio Inc., China) according to the manufacturer’s recommended protocol. The cDNA samples were diluted at 1:10 in DEPC-treated water and stored at -20°C.

Analysis of mRNA transcripts by quantitative real time PCR (qRT-PCR)

qRT-PCR was performed using a quantitative PCR kit (TaKaRa SYBR Premix Ex TaqTM II; Takara Bio Inc., China). The primers of HDPs were designed by Primer Express 3.0 according to the coding sequences of the respective chicken genes in the National Center for Biotechnology Information database and synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China). Detailed information for the primers of HDPs and the annealing temperature set in this experiment are presented in Table I. The thermal cycling parameters were used for qRT-PCR as previously described (Wang et al., 2018). Expression levels of HDPs relative to the housekeeping gene 18SrRNA were determined with the QuantStudio™ 6 Flex Real-Time PCR System Software (Applied Biosystems, USA).

Statistical analysis

The qRT-PCR data was analyzed using the 2−ΔΔCt method. The results represent mean fold change from the control group A ± standard error. The significance of differences among different groups was analyzed using SPSS Statistics 17.0 (IBM Company, New York, NY, USA). The data of qRT-PCR was used by one-way ANOVA to identify treatment differences which were considered significant when P < 0.05.

 

Results

Reproduction of the thiram-induced TD

A dramatic increase of TD chickens was observed on day 12 and then the clinical signs of TD chickens significantly recovered on day 23, and the clinical signs and pathological characteristics of thiram induced TD has been showed in our recently published research (Wang et al., 2018).

 

Table I.- Primer sequences and reference genes used for quantitative real-time PCR.

Target genes	Primer sequence (5′→3′)	Annealing temp.	GenBank accession number
AvBD1	F: CCGTTTCTGTCACCGTCA R: CCTTTGCTAAAAATCCCTTC	57°C	NM_204993.1
AvBD2	F: GCACTCCAGGTTTCTCCA R: GGCGTCCGACTTTGATTA	57°C	DQ677633.1
AvBD4	F: TCATGGAGCTGTGGGCTTTT R: AGCATTCCCATAAGGGCATT	55°C	NM_001001610.2
AvBD6	F: CTGCTGCTGTCTGTCCTCTT R: TGCAGACACCCCTTTGATAT	55°C	NM_001001193.1
AvBD7	F: CTATTGATACTTGTTGGCTTCG R: AACTCCTCCATCCCCTTG	57°C	AY621322.1
CATH-2	F: GACGACTGCGACTTCAAGGA R: CGTCTCTGCAGCGTAGATTG	55°C	KT962965.1
NK-lysin	F: TTCTGCGTCAGTCTGGTGAA R: TCCCCGTACTGCACACCTT	55°C	KT962967.1
LEAP-2	F: ACTCTGGAATTCTGCCTGATGACA R: CATCTGCATCCGTGCCTGA	57°C	NM_001001606.1
18SrRNA	F: TTCCGATAACGAACGACAC R: GACATCTAAGGGCATCACAG	55°C	FM165414

 

Erythrocytes constitutively express many HDPs at the transcript level

To determine the repertoire of HDPs expressed in chicken erythrocytes, the transcript levels of HDPs in erythrocytes of control group (group A) was assayed by using qRT-PCR (Fig. 1). The results showed that erythrocytes constitutively expressed transcripts for AvBD 1, 2, 4, 6, 7, CATH-2, NK-lysin and LEAP-2. Among the transcripts, the LEAP-2 was the most abundant while the AvBD4 was least abundant.

Effects of rGSTA3 protein and thiram-induced TD on the mRNA expression of HDPs in erythrocytes

The gene expression patterns of HDPs in erythrocytes were quite different among the groups. The effects of the rGSTA3 protein and thiram-induced TD on the expression of HDPs in erythrocytes on day 12 and 23 are shown in Figures 2 and 3. In 12-day-old birds, stimulation with 50 μg/kg rGSTA3 protein resulted in the significant upregulation of 6 types of HDPs (AvBD1, 2, 4, 6, 7 and LEAP-2) in rGSTA3-injected birds compared with those from the control group (P < 0.05). The transcripts of AvBD1, 4 and 6 were significantly upregulated by 50 μg/kg rGSTA3 protein in thiram-treated birds and control birds (P < 0.05). The expression of LEAP-2 mRNA was upregulated (P < 0.05) by thiram. On the contrary, thiram significantly reduced the expression of AvBD2, AvBD7, CATH-2 and NK-lysin in 12-day-old birds (P < 0.05). In 23-day-old birds, the expression of AvBD1, AvBD2, AvBD7, CATH-2 and LEAP-2 showed a dose-dependent pattern in response to rGSTA3 protein in thiram-fed groups. Moreover, thiram significantly reduced the transcripts of AvBD1, 2, 4, 6, 7, LEAP-2 and NK-lysin (P < 0.05). In addition, after the 50 μg/kg of rGSTA3 protein stimulation, the highest upregulation was detected for NK-lysin with 60.2-fold higher expression compared with the control group (P < 0.01).

 

 

Discussion

TD is an avian pervasive disease, in which growth plate cartilage accumulates in the metaphyseal region of the tibiotarsus and chondrocytes a large number of nonviable cells that can cause inflammation (Orth and Cook, 1994). Recent studies have reported that erythrocytes have a direct role in the immune response and can produce many cytokines and AvBDs in response to some pathogens and proinflammatory factors (Morera and MacKenzie, 2011; St Paul et al., 2013). It has also been shown that tibial angiogenesis in the hypertrophic zone was strongly suppressed by thiram-induced TD (Huang et al., 2017). These clues suggested that the development of TD may be associated with the immune response of chicken erythrocytes in the blood vessels. In this study, we explored the effects of rGSTA3 protein and thiram-induced TD on the expression of HDPs in erythrocytes. Here, we found chicken erythrocytes constitutively express many HDPs transcripts and the expression of HDPs has remarkable changes after stimulation of rGSTA3 protein and thiram-induced TD.

In the current study, the results indicated that erythrocytes constitutively expressed transcripts of AvBDs, LEAP-2, CATH-2 and NK-lysin with the transcript of LEAP-2 being the most abundant. Previous report showed that LEAP-2 was highly expressed in the chicken liver and human blood (Krause et al., 2003; Lynn et al., 2003). The data indicated that HDPs especially LEAP-2 may participate in the immune response of many diseases including TD. In addition, the results of this study showed that thiram-induced TD significantly upregulated the expression of LEAP-2 mRNA, but significantly reduced the expression of AvBD2, AvBD7, CATH-2 and NK-lysin in 12-day-old birds. The results suggested that thiram-induced TD induced the synthesis of LEAP-2 and disturbed the expression of AvBD2, AvBD7, CATH-2 and NK-lysin. At 23-day-old, thiram-induced TD not only significantly reduced the transcript of NK-lysin, which is similar to 12-day-old birds, but also significantly decreased the transcripts of AvBD1, 2, 4, 6, 7 and LEAP-2. These results evidenced that thiram-induced TD can lead to a certain extent damage of the immune system with the suppressed immune function of many HDPs. Similarly, it was recently reported that antiapoptotic proteins in erythrocytes were suppressed in the initial stage of TD and induced in TD recovery (Wang et al., 2018). Further, it has been showed that the angiogenesis can be inhibited by thiram-induced TD, and the occurrence of TD can be caused by the angionecrosis in growth plate (Marikovsky, 2002; Rath et al., 2005). In the present study, the transcripts of 6 types of HDPs (AvBD1, 2, 4, 6, 7 and LEAP-2) were significantly upregulated by stimulation with 50 μg/kg rGSTA3 protein in 12-d-old birds, but were recovered to the normal level at 23 d old. These results showed that high level of rGSTA3 protein can induce AvBD1, 2, 4, 6, 7 and LEAP-2 expression to enhance immune response in initial stage of TD, but their expression restore to the original level in the recovery phase of TD. Moreover, our group has recently reported that AvBDs in chicken erythrocytes may participate in MDV-induced host immune responses (Niu et al., 2018). At 12-day-old, the transcripts of AvBD1, 4 and 6 were significantly upregulated by 50 μg/kg rGSTA3 protein in thiram-fed birds and basal diet birds; AvBD1, 2, 7, CATH-2 and LEAP-2 showed a dose-dependent expression in response to rGSTA3 protein in thiram-fed groups at 23-day-old. These results suggest that the recombinant protein could initiate a vigorous immune response by stimulating the expression of various HDPs in erythrocytes. Similarly, we have also reported that rGSTA3 protein participated in the recovery of TD by promoting the expression of apoptosis-related genes in erythrocytes (Wang et al., 2018). NK-lysin, a member of HDPs, was generally considered to be produced by cytotoxic T cells and natural killer cells (Peña et al., 1997). It has diverse immunomodulatory capabilities, such as the modulation of pro-inflammatory and anti-inflammatory responses, angiogenesis, wound-healing and apoptosis (Hilchie et al., 2013; Kim et al., 2017; Mansour et al., 2014). In the current study, after 50 μg/kg of rGSTA3 stimulation, the highest upregulation was detected for NK-lysin with 60.2-fold higher expression in 23-day-old compared with the basal diet-fed controls. The result showed that NK-lysin transcript also existed in chicken erythrocytes, and it is possible that rGSTA3 protein promotes the regulation of growth plate vascularization and chondrocyte maturation by stimulating the expression of NK-lysin in erythrocytes. As of yet, it is still not very clear as to what the biological function of HDP-stimulated erythrocytes is during the development of TD. There is one possible immunological role for HDPs in chicken erythrocytes that toll-like receptors (TLRs) recognize some proinflammatory factor produced in the process of TD, and then induce intracellular signals through NF-kB-dependent pathways to induce HDPs and cytokine expression that enhance the phagocytic activity (St Paul et al., 2013; Zarember et al., 2002).

 

Conclusion

The expression of HDPs transcripts is very different in chicken erythrocytes. In the development of TD, many HDPs expression were suppressed by thiram-induced TD, and rGSTA3 protein promoted the immune response by up-regulating the expression of HDPs. which suggested that these HDPs expression is highly related to thiram-induced TD, and rGSTA3 protein can induce the expression of all HDPs to promote the recovery of TD. Further studies are needed to elucidate the mechanism of HDPs in response to the rGSTA3 protein as well as thiram-induced TD, and the association between the expression of these peptides and the development of the TD.

 

Acknowledgements

This work was supported by The National Key Research and Development Program of China (2016YFD0500800), the National Natural Science Foundation of China (31072179), Key Technologies R and D Program of Shanxi Province (20130311027-3), Research Project Supported by Shanxi Scholarship Council of China and “131” leading talent project of Colleges and universities in Shanxi province. The authors are very thankful to TuoyingAo (Alltech, USA) for help with English language quality of the manuscript.

 

Statement of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this article.

 

References

Butler, V.L., Mowbray, C.A., Cadwell, K., Niranji, S.S., Bailey, R., Watson, K.A. and Hall, J., 2016. Effects of rearing environment on the gut antimicrobial responses of two broiler chicken lines. Vet. Immunol. Immunopathol., 178: 29-36. https://doi.org/10.1016/j.vetimm.2016.06.004

Chang, M., Hong, Y., Burgess, J.R., Tu, C.P. and Reddy, C.C., 1987. II. Isozyme specificity of rat liver glutathione S-transferases in the formation of PGF2α and PGE2 from PGH2. Arch. Biochem. Biophys., 259: 548-557. https://doi.org/10.1016/0003-9861(87)90521-2

Cuperus, T., Coorens, M., van Dijk, A. and Haagsman, H.P., 2013. Avian host defense peptides. Dev. Comp. Immunol., 41: 352-369. https://doi.org/10.1016/j.dci.2013.04.019

Gay, C., Gilman, V. and Leach, Jr. R., 2007. Immunolocalization of vascularization factors in normal, tibial dyschondroplasia and rachitic cartilage. Avian Pathol., 36: 445-451. https://doi.org/10.1080/03079450701591387

Hilchie, A.L., Wuerth, K., and Hancock, R.E., 2013. Immune modulation by multifaceted cationic host defense (antimicrobial) peptides. Nat. Chem. Biol., 9: 761-768. https://doi.org/10.1038/nchembio.1393

Huang, S., Rehman, M., Lan, Y., Qiu, G., Zhang, H., Iqbal, M., Luo, H., Mehmood, K., Zhang, L. and Li, J., 2017. Tibial dyschondroplasia is highly associated with suppression of tibial angiogenesis through regulating the HIF-1Α/VEGF/VEGFR signaling pathway in chickens. Scient. Rep., 7: 9089. https://doi.org/10.1038/s41598-017-09664-6

Ilic, Z., Crawford, D., Egner, P.A. and Sell, S., 2010. Glutathione-S-transferase A3 knockout mice are sensitive to acute cytotoxic and genotoxic effects of aflatoxin B1. Toxicol. appl. Pharmacol., 242: 241-246. https://doi.org/10.1016/j.taap.2009.10.008

Kim, W.H., Lillehoj, H.S. and Min, W., 2017. Evaluation of the Immunomodulatory Activity of the Chicken NK-Lysin-Derived Peptide cNK-2. Scient. Rep., 7: 45099. https://doi.org/10.1038/srep45099

Krause, A., Sillard, R., Kleemeier, B., Klüver, E., Maronde, E., Conejo-García, J.R. and Wattler F., 2003. Isolation and biochemical characterization of LEAP-2, a novel blood peptide expressed in the liver. Protein Sci., 12: 143-152. https://doi.org/10.1110/ps.0213603

Lee, Y.J., Lee, J.S., Kang, E.H., Lee, Y.K., Kim, S.Y., Song, Y.W. and Koo, K.H., 2012. Vascular endothelial growth factor polymorphisms in patients with steroid-induced femoral head osteonecrosis. J. Orthop. Res., 30: 21-27. https://doi.org/10.1002/jor.21492

Li, T.F., Zuscik, M.J., Ionescu, A.M., Zhang, X., Rosier, R.N., Schwarz, E.M., Drissi, H. and O’keefe, R.J., 2004. PGE2 inhibits chondrocyte differentiation through PKA and PKC signaling. Exp. Cell Res., 300: 159-169. https://doi.org/10.1016/j.yexcr.2004.06.019

Lynn, D.J., Lloyd, A.T. and O’Farrelly, C., 2003. In silico identification of components of the Toll-like receptor (TLR) signaling pathway in clustered chicken expressed sequence tags (ESTs). Vet. Immunol. Immunopathol., 93: 177-184. https://doi.org/10.1016/S0165-2427(03)00058-8

Mansour, S.C., Pena, O.M. and Hancock, R.E., 2014. Host defense peptides: Front-line immunomodulators. Trends Immunol., 35: 443-450. https://doi.org/10.1016/j.it.2014.07.004

Marikovsky, M., 2002. Thiram inhibits angiogenesis and slows the development of experimental tumours in mice. Br. J. Cancer, 86: 779-787. https://doi.org/10.1038/sj.bjc.6600078

Morera, D. and MacKenzie, S.A., 2011. Is there a direct role for erythrocytes in the immune response? Vet. Res., 42: 89. https://doi.org/10.1186/1297-9716-42-89

Nabi, F., Zhang, H., Iqbal, M.K., ur Rehman, M., Shahzad, M., Mehmood, K. and Li, J., 2018. Salvia Miltiorrhiza Reinstates growth plate width, reduces liver oxidative stress and toxicity in avian tibial dyschondroplasia. Pakistan J. Zool., 50: 1553-1556. http://doi.org/10.17582/journal.pjz/2018.50.4.sc6

Nagahama, K., Aoki, K., Nonaka, K., Saito, H., Takahashi, M., Varghese, B. and Ohyama, K., 2004. The deficiency of immunoregulatory receptor PD-1 causes mild osteopetrosis. Bone, 35: 1059-1068. https://doi.org/10.1016/j.bone.2004.06.018

Niu, S., Jahejo, A.R., Jia, F., Li, X., Ning, G., Zhang, D., Ma, H., Hao, W., Gao, W., Zhao, Y., Gao, S., Li, G., Li, J., Yan, F., Gao, R., Bi, Y., Han, L., Gao, G.F. and Tian, W., 2018. Transcripts of antibacterial peptides in chicken erythrocytes infected with Marek’s disease virus. BMC Vet. Res., 14: 363. https://doi.org/10.1186/s12917-018-1678-7

O’Keefe, R.J., Crabb, I.D., Puzas, J.E. and Rosier, R.N., 1992. Influence of prostaglandins on DNA and matrix synthesis in growth plate chondrocytes. J. Bone Min. Res., 7: 397-404. https://doi.org/10.1002/jbmr.5650070407

Orth, M. and Cook, M., 1994. Avian tibial dyschondroplasia: A morphological and biochemical review of the growth plate lesion and its causes. Vet. Pathol., 31: 403-414. https://doi.org/10.1177/030098589403100401

Peña, S.V. and Krensky, A.M., 1997. Granulysin, a new human cytolytic granule-associated protein with possible involvement in cell-mediated cytotoxicity. Semin. Immunol., 2: 117-125.

Philippart, C., Tzehoval, E., Moricard, Y., Bringuier, A.F., Seebold, C., Lemoine, F.M., Arys, A., Dourov, N. and Labat, M.L., 1993. Immune cell defects affect bone remodelling in osteopetrotic op/op mice. Bone, 23: 317-332. https://doi.org/10.1016/S0169-6009(08)80106-7

Rath, N.C., Richards, M.P., Huff, W.E., Huff, G.R. and Balog, J.M., 2005. Changes in the tibial growth plates of chickens with thiram-induced dyschondroplasia. J. Comp. Pathol., 133: 41-52. https://doi.org/10.1016/j.jcpa.2005.01.005

Rath, N., Huff, W. and Huff, G., 2007. Thiram-induced changes in the expression of genes relating to vascularization and tibial dyschondroplasia. Poult. Sci., 86: 2390-2395. https://doi.org/10.3382/ps.2007-00219

Semple, F. and Dorin, J.R., 2012. β-Defensins: multifunctional modulators of infection, inflammation and more? J. Innate. Immun., 4: 337-348. https://doi.org/10.1159/000336619

St Paul, M., Paolucci, S., Barjesteh, N., Wood, R.D. and Sharif, S., 2013. Chicken erythrocytes respond to Toll-like receptor ligands by up-regulating cytokine transcripts. Res. Vet. Sci., 95: 87-91. https://doi.org/10.1016/j.rvsc.2013.01.024

Street, J., Bao, M., Bunting, S., Peale, F.V., Ferrara, N., Steinmetz, H., Hoeffel, J., Cleland, J.L., Daugherty, A., van Bruggen, N. and Redmond, H.P., 2002. Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc. natl. Acad. Sci. U.S.A., 99: 9656-9661. https://doi.org/10.1073/pnas.152324099

Tian, W.X., Li, J.K., Qin, P., Wang, R., Ning, G.B., Qiao, J.G., Li, H.Q., Bi, D.R., Pan, S.Y. and Guo, D.Z., 2013. Screening of differentially expressed genes in the growth plate of broiler chickens with tibial dyschondroplasia by microarray analysis. BMC Genomics, 14: 276. https://doi.org/10.1186/1471-2164-14-276

Townsend, D.M. and Tew, K.D., 2003. The role of glutathione-S-transferase in anti-cancer drug resistance. Oncogene, 22: 7369-7375. https://doi.org/10.1038/sj.onc.1206940

Van Dijk, A., Veldhuizen, E.J. and Haagsman, H.P., 2008. Avian defensins. Vet. Immunol. Immunopathol., 124: 1-18. https://doi.org/10.1016/j.vetimm.2007.12.006

Wang, C.X., Niu, S., Jahejo, A.R., Jia, F.J., Li, Z., Zhang, N., Ning, G.B., Zhang, D., Li, H.Q., Ma, H.L. and Hao, W.F., 2018. Identification of apoptosis-related genes in erythrocytes of broiler chickens and their response to thiram-induced tibial dyschondroplasia and recombinant glutathione-S-transferase A3 protein. Res. Vet. Sci., 120: 11-16. https://doi.org/10.1016/j.rvsc.2018.08.001

Zanetti, M., 2005. The role of cathelicidins in the innate host defenses of mammals. Curr. Issues Mol. Biol., 7: 179-196.

Zarember, K.A. and Godowski, P.J., 2002. Tissue expression of human Toll-like receptors and differential regulation of toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol., 168: 554-561. https://doi.org/10.4049/jimmunol.168.2.554

Zhang, J.P., Deng, Y.F., Zhou, Z.L., Hou, J.F., 2013. Expression and identification of recombinant chicken vascular endothelial growth factor in Pichia pastoris and its role in the pathogenesis of tibial dyschondroplasia. Poult. Sci., 92: 3214-3227. https://doi.org/10.3382/ps.2013-03420