Incidence, serologic and molecular characterization of Potato virus S from commercial potato in Egypt
Incidence, serologic and molecular characterization of Potato virus S from commercial potato in Egypt
Salama M. El-Saghir1, 2
ABSTRACT
Background: In Egypt potato crop is affected heavily by a wide variety of viruses, viz. PVY, PLRV,
and PVX. Potato virus S (PVS), family Betaflexiviridae; genus Carlavirus) is one of the most common
potato (Solanum tuberosum L.) viruses found infecting potato worldwide. PVS was detected only
once in Egypt in 1988. However no further studies have been made on it in Egypt recently. PVSinfection
to potatoes causes mild symptoms, viz. rugosity, mosaic, stunting, leaf bronzing, and early
leaf dropping. Heavy losses; however, can occur upon mixed infection with PVS and PVX or PVM.
Objective: The objective of this study is to characterize the incidence of PVS serologically with
authentic antiserum for PVS and, molecularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of PVS in Egypt for the second time; yielding 187
bp of the virus coat protein.
Conclusion: Presence of PVS was reconfirmed in Egypt using both serology and IC RT-PCR.
Previous finding showed that PVS alone causes 3 to 20% tuber yield loss. However, heavier losses
(40%), through synergistic interactions, can occur upon its mixed infection with PVX or PVM.
Therefore, PVS indexing in potato should be put into action along with other potato viruses in Egypt.
To share on other social networks, click on any share button. What are these?
January 2017
Vol. 1, Iss. 1, Pages 1-162
