Research Article

Cytokines and Performance Analysis of Broiler Chickens Challenged with Avian Pathogenic E.coli After Administration of Various Immune modulatory Agents

Ahmed H. Abed1, Ahmed Orabi2*, Wafaa Hassan3, , Enas Hammad4 , Ghada Gaber5

1Bacteriology, Mycology and Immunology Department, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt, 62511; 2Microbiology Department, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt, 11221; 3Chef Researcher of Poultry Diseases and The Director of Reference Lab for Veterinary Quality Control of Poultry Production, Egypt; 4Researcher in Poultry Diseases Department, Mansoura Lab Animal Health Research Institute, Arc, Egypt; 5Research Assistant of Reference Lab for Veterinary Quality Control of Poultry Production, Egypt.

Received | July 05, 2022; Accepted | August 15, 2022; Published | October 20, 2022

*Correspondence | Ahmed Orabi, Microbiology Department, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt, 11221; Email: orabi.vet@cu.edu.eg

Citation | Abed AH, Orabi A, Hassan W, Hammad E, Gaber G (2022). Cytokines and performance analysis of broiler chickens challenged with avian pathogenic E.coli after administration of various immune modulatory agents. Adv. Anim. Vet. Sci. 10(11): 2438-2446.

DOI | http://dx.doi.org/10.17582/journal.aavs/2022/10.11.2438.2446

ISSN (Online) | 2307-8316

 

 

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Avian colibacillosis caused by enterotoxigenic E. coli is a serious infectious disease occurring in different types of chickens (He et al., 2014) as estimated to cause a great hazard in the global poultry industry (Wade and Keyburn, 2015). The discovery of 8-13 virulence genes in highly pathogenic E. coli isolates or 5-8 virulence genes in intermediate pathogenic E. coli isolates is attributed to Avian pathogenic E.coli virulence (Wang et al., 2015). Several virulence genes were investigated in Egypt, they differed depending on the geographic location. Pathogenic strains were observed to consistently carry the virulence gene pattern of fimH, fimA (fimbriae gene cluster), and papC(pilus associated with pyelonephritis) in a few in vivo assays, iutA(ferric aerobactin outer membrane receptor gene), and tsh (temperature sensitive hemagglutinin), which were linked to fatality in one-day-old chicks (Ali et al., 2019). The increasing prevalence of APEC that is antibiotic resistant poses a zoonotic danger in poor economies (Abdallah et al., 2015; El-Shazly et al., 2017). To prevent E. coli infection in chicken, alternatives such as probiotics, lectins, and essential oils are being developed (Projahn et al. 2018; Jiang et al. 2019)., a result of their antibacterial properties as a substitute for antibiotic resistance pathogens recent research has focused on the medicinal and preventive applications of lectins (Iordache et al., 2015). A novel lectins isolated from the mushroom’s fruiting bodies demonstrated antibacterial action against E. coli (Jiang et al. 2019). Furthermore, lectins had an immune modulatory effect via causing macrophages and tumour necrosis factor (TNF) to become active, promoting the expression of IL-2 and IFN genes, and therefore upregulating the T-helper-1 cell population (She et al., 1998). Probiotics are live, non-pathogenic microbial feed supplements that provide health advantages to the host and are thought to be a viable option for preventing and treating bacterial illnesses (Gareau et al., 2010). Lactobacillus acidophilus has also been shown to improve immune function by boosting both innate and adaptive immune responses (Liu et al., 2010). Lactobacillus acidophilus is a potent inducer of T-helper 1 (Th1) cytokines, such as interleukin (IL-12) and interferon (IFN), according to some in vitro research (Gackowska et al., 2006; Zeuthen et al., 2006). Essential oils (EO) have been gaining popularity as a result of consumer preference for natural products (Brenes and Roura, 2010). Additionally, Improvements in cellular and humoral immunity have been linked to 5EO supplementation in hens (Lee et al., 2011; Awaad et al., 2014) as well as regulate the host immunity gene expression (Kim et al., 2010). The two isomers thymol and carvacrol, which are also essential components of frequently used herbs like thyme and oregano, are among the thousands of EO constituents have strong antibacterial properties (Bassole and Juliani, 2012). Thymol and carvacrol have been shown in experiments to block pro-inflammatory cytokines, decrease inflammatory cell recruitment, and reduce oxidative damage (Riella et al., 2012; Guimaraes et al., 2012). In the current study, the influence of administrated lectins, probiotic and essential oils on the health and immunity of diseased broiler chickens infected with avian pathogenic E. coli was studied.

Materials and methods

Ethical approval

The Faculty of Veterinary Medicine, Beni-suef University, Egypt, followed Animal Research Ethics Guidelines for conducting this work with Ethical approval number. (021-195)

Experimental chickens

A commercial hatchery provided 120 one-day-old commercial broiler chicks. The birds were raised in separate rooms in metal cages and were1lit continuously and fed antibiotic-free traditional broiler feeds at will.

Escherichia coli Challenge Isolate

One strain of E. coli O78 was isolated and identified from a broiler with respiratory illness. broiler hens. Congo-red binding assay and virulence gene identification indicated that the bacteria were pathogenic (Ali et al., 2019). McFarland’s barium sulphate standard solution was used to adjust the bacterial suspension to include 108 CFU/mL- (Nagano et al., 2012). Subcutaneously, each APEC strain in 0.5 mL (108 CFU/mL). was used in the challenge (Abd El-Mawgoud et al., 2020).

Administrated lectins, probiotic and essential oils

A commercial product called Lector50®, manufactured by Microbiotech INT. INC. in the USA, including 15,000 mg of lectin, 5000 mg of xylitol, 15,000 mg of fructo-oligosaccharide, and 30,000 mg/liter of NaCl, was employed.

Probac® contains mixed types of Lactobacillus spp. and essential oil obtained from sigma Aldrich.

Experiment Design

A total of 120 broiler chicks were separated into eight groups of equal number (15 birds for each group). A negative control group was the first group. Immune modulatory agents such as lectins (0.5 mL/L drinking water), probiotic 0.25 g/L in water supply) and 0.5 mL of an essential oil in drinking water) were given to three groups, separately for five days without being challenged, and the other group acted as the E. coli O78 challenged control. Immune modulatory agents were given to the remaining three groups, which were also infected with E. coli O78 (Table 1).

Evaluation of the Performance Parameters

Each group’s average body weight was measured on a weekly basis. By dividing the total amount of feed consumed by the increase in the total mass of the hens in each group, conversion ratios (FCR) for each group were estimated. (Coneglian et al., 2010).

The Clinical signs and post mortem lesions

The clinical symptoms were documented in accordance with Nagano et al. (2012), and the postmortem lesions were documented in accordance with Rawiwet and Chansiripornchai (2009).

Cytokines assay using qRT- PCR;

RNA extraction from spleen samples was applied
according to Yuan et al. (2006) by using RNeasy Mini Kit, and the reaction was prepared by using specific primes
for IL-4, IL-6, and IFNG (Table 2). Amplification curves and ct values were determined by the stratagene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the positive control group

 

Table 1: Experimental design

Groups	infection with E. coli O78	Lector 0.5ml/L in the drinking water for 5days at age of 25 days	Probiotic 1ml/L in the drinking water for 5days at age of 25 days	Essential oil 0.5ml/L in the drinking water for 5days at age of 25 days
1.Negative control	-	-	-	-
2.Positive control	+	-	-	-
3.gp. administrated lector without challenge	-	+	-	-
4.gp. administrated probac without challenge	-	-	+	-
5.gp. administrated E. O without challenge	-	-	-	+
6.gp. administrated lector with challenge	+	+	-	-
7.gp. administrated probac with challenge	+	-	+	-
8.gp. administrated E. O. with challenge	+	-	-	+

 

Table 2: Primers used

Gene	Primer sequence (5'-3')	Reference
IL6	GCTCGCCGGCTTCGA	Suzuki et al., 2009
	GGTAGGTCTGAAAGGCGAACAG
	(FAM) AGGAGAAATGCCTGACGAAGCTCTCCA (TAMRA)
IL4	AACATGCGTCAGCTCCTGAAT
	TCTGCTAGGAACTTCTCCATTGAA
	(FAM) AGCAGCACCTCCCTCAAGGCACC (TAMRA)
28SrRNA	GGCGAAGCCAGAGGAAACT
	GACGACCGATTTGCACGTC
	(FAM) AGGACCGCTACGGACCTCCACCA (TAMRA)
IFN-G	AAACAACCTTCCTGATGGCGT	Markowski-Grimsrud and Schat, 2003
	CTGGATTCTCAAGTCGTTCATCG
	(FAM) TGAAAGATATCATGGACCTGGCCAAGCTC (TAMRA)

 

Table 3: Zoo-technical results of the experimental groups

Group	Clinical signs	Postmortem lesions	Mortality rates	Re-isolation rates
Negative Control	None	none	none	None
Positive Control E. coli O78	Respiratory signs-off food- dullness depression- brownish diarrhea-reluctance to walk	Pericarditis-air sacculitis- Cellulitis-	40%	80%
Gr. administrated lectin without challenge	None	None	none	None
Gr. administrated probiotic without challenge	None	None	none	None
Gr. administrated E.O without challenge	None	none	13.3%	None
Gr. administrated lectins with challenge	Brownish diarrhea-dullness-off food -un ability to walk	Cellulitis-congestion of liver and spleen -	6.6%	40%
Gr. administrated probiotic with challenge	Dullness-depression-off food- diarrhea	Turbid air sac-pericarditis	10%	40%
Gr. administrated E. O. with challenge	Reluctance to walk-brownish diarrhea-off food-rales	Ascites- cellulitis-mild pericarditis and air saculitis	13.3%	60%

 

Table 4: Results of the performance parameters in the experimental groups

Groups	BWT (g)	Feed intake(g)	BWT gain(g)	FCR
Negative Control	14250.33	7870.24	5500.32	1.430.22
Positive control	9650.45	4000.42	1500.43	2.670.45
Gr. administrated lectins without challenge	14800.22	7980.23	6300.24	1.260.26
Gr. administrated Probiotic without challenge	15500.33	8200.43	6870.44	1.1942
Gr. administrated E.O. without challenge	14500.35	7300.42	5700.43	1.280.34
Gr. administrated lectins with challenge	10200.33	4500.45	1650.48	2.730.34
Gr. administrated Probiotic with challenge	11700.22	5750.43	3200.34	1.80.52
Gr. administrated E.O. with challenge	9800.44	4150.45	1450.52	2.860.56

E.O.: essential oil

 

Table 5: Results of cytokines analysis in the experimental groups

Group ID	IL4		IL6		INFG
	CT	Fold change	CT	Fold change	CT	Fold change
Negative Control	22.15 1.2	--	21.30 1.4	--	22.04 2.4	--
Positive control	25.56 2.1	0.19140.32	18.99 1.4	10.05611.3	20.18 2.4	7.38711.8
Gr. administrated lectins without challenge	20.29 2.3	8.33970.25	24.79 1.5	0.20450.33	24.88 2.5	0.32140.45
Gr. administrated Probiotic without challenge	20.71 2.2	4.80650.38	23.45 1.6	0.39980.42	23.71 3.2	0.55860.34
Gr. administrated E.O. without challenge	21.69 1.6	4.09110.34	23.12 2.2	0.84380.34	24.11 3.2	0.71080.45
Gr. administrated lectin with challenge	22.95 1.7	0.83620.22	20.18 1.5	3.16021.3	21.52 2.4	2.08781.5
Gr. administrated Probiotic with challenge	23.34 1.5	0.68110.23	19.19 1.4	6.69002.4	20.64 3.2	4.09542.4
Gr. administrated E.O. with challenge	23.99 1.6	0.42930.24	19.07 2.3	7.19002.3	20.33 2.4	5.01413.1

 

according to the “ΔΔCt” method stated by Yuan et al., 2006 using the following ratio: (2-ct).

Whereas ΔΔCt = ΔCtreference - ΔCttarget

ΔCt target = Ct control – Ct treatment and ΔCt reference = Ct control- Ct treatment

E: efficiency of amplification.

Re isolation of the avian pathogenic E. coli

Ten grams of solid sample from heart, and liver in 90 ml normal saline was prepared, followed by enrichment for 24 h incubation at 37°C in non-differential broth such as nutrient broth, according to Irwin et al. (2010). This technique allows E. coli to multiply before being streaked on EMB agar and biochemically identified.

Statistical analysis

The results were presented as means± SE. All given parameters were compared between the control group and the experimental groups using the one way ANOVA with fixed effects of the factors using statistica 6.0 (Start Soft INC.). Differences were considered significant at p˂0.05.

RT-PCR plots showing fold change amplification for different cytokines indices of different experimental groups using specific probe

 

a-Interferon gamma

 

b-Interleukin 4

 

c-Interleukin6

 

d-28SrRNA

Results

The clinical symptoms, mortality rates and re isolation rates

All of the administered groups had significantly reduced clinical symptoms, post mortem lesions, and reisolation rates than the challenge control group (Table 3).

The assessment of performance

performance review The average body mass of the birds across all groups was remarkably consistent. before challenge while, after the challenge, significant differences in both bodyweights and FCR were noticed (Table 4).

Avian cytokines gene expression analysis using qRT- PCR:

Lectins administrated group: There was an increase of IL-4 in lectins group fold change than other groups before challenge to 8.3397, and to 0.8362 after challenge in comparison with positive control group (0.1914). While, IL-6 and INFG fold change were linearly inhibited in IL-6 from10.0561 to 0.2045 before challenge, to 3.1602 after challenge, INFG fold change from 7.3871 to 0.3214 before challenge, and to 2.0878 (Table 4).

Probiotic administrated group: There was an increase of IL-4 in probiotic group fold change before challenge to 4.8065, and to 0.6811 after challenge in comparison to positive control group (0.1914). While, IL-6, and INFG fold change were linearly inhibited in IL-6 from10.0561 in positive control group to 0.3998 before challenge, to 6.6900 after challenge, INFG fold change from 7.3871 to 0.5586 before challenge, and to 4.0954 after challenge.

Essential oil administrated group

There was an increase of IL-4 in essential oil group fold change before challenge to 4.8065, and to 0.6811 after challenge in comparison with positive control group (0.1914). While, IL-6 and INFG fold change were linearly inhibited in IL-6, from 10.0561 in positive control group to 0.3998 before challenge, to 6.6900 after challenge, INFG fold change from 7.3871 to 0.5586 before challenge and to 4.0954 after challenge (Table 5).

Discussion

Mannose-binding lectins (MBL) are also considered a member of the PRR family. It is a soluble-type protein which can also be considered as an effector molecule. MBL binding to PAMPs on pathogen cell walls can trigger complement activation via the lectins route, which further neutralizes infections by aggregating them (denying attachment of bacteria to epithelial cells of host). MBL can also bind apoptotic cells on the phagocyte membrane via ligation (the joining of two DNA strands by a phosphate ester bond) (Nielsen et al., 1999). For organogenesis, tissue upkeep, and optimal immune system function, apoptotic cells must be eliminated. The term «acute-phase protein» refers to proteins that respond to inflammatory signals by elevating their plasma concentration by at least 25%. These proteins serve as transport proteins and have antioxidant action in addition to participating in the host’s protection and adaptation. (Norup et al., 2009). Mannose-binding lectin is an inherent host defense protein that has a high affinity to initiate the complement lectins pathway via a serine protease linked to the mannose-binding lectins (MASP-2) (Zhang et al., 2017; Ulrich-Lynge et al., 2015). wide range of protections against the physiochemical actions of pathogens are provided by the MBL structure.(Takahashi, 2011). Lectins were shown to affect the levels of several cytokine mRNAs. In lectins-treated splenic lymphocytes, the expression of IL-2 and IFN-g was significantly increased. This was explained in the current study, as the group administrated lectins elevated level of IL-4 gene expression to 8.3397 before challenge, and to 0.8362 after challenge in comparison to positive control group (0.1914). While, the level of INFG and IL-6 decreased from 7.3871 to 2.0878, and from 10.0561 to 3.1602 after challenge, respectively, and that was in agreement with other study done by Park et al. (2010).

To combat pathogenic organisms, various tactics have been utilized. Antibiotic-resistant organisms and diseases have grown to be a significant public health concern due to the abuse of antibiotics by people and animals, as well as environmental changes, .Probiotics are being regarded as an extra effective technique for illness prevention and treatment alongside the development of medicines and vaccinations. Probiotic bacteria have grown in popularity as a mean of enhancing both innate and adaptive immune responses (Liu et al., 2010; Konstantinov et al., 2008). Antimicrobial activity is one of probiotics’ positive qualities. This is due to a variety of causes, including lower pH levels (due to lactic acid generation), and the formation of bacteriocins with bactericidal or bacteriostatic properties (Parente and Ricciardi, 1999). The current study found that giving broilers a probiotic, helped them recover from the growth inhibition caused by E. coli infection. Probiotics’ favorable benefits on broiler growth performance are similar with findings from earlier studies utilizing probiotics in broilers (Zulkifli et al., 2000; Wang et al., 2017). Immune regulatory peptides; known as cytokines; play a role in both innate and adaptive immune responses. They have a critical function in immunological system control (Tayal and Kalra, 2008). Th2 cells generate IL-4 in response to antigenic stimulation. Up regulation of IL-4 levels has been linked to E. coli infection (Zhang et al., 2013), which explains the increase in the Fold Change of IL-4 from 0.1914 to 0.6811 following infection. Interferon- has been identified as a pro-inflammatory cytokine that causes immunopathology in a variety of inflammation models (Van Holten et al., 2004).

The present study showed that administration of probiotic decreases fold change of IL-6 from 10.0561 to 6.6900, and the level of fold change of INFG from 7.3871 to 4.0954, and IL-6 from 10.0561 to 6.6900, suggesting that probiotics had an anti-inflammatory effect. Finally, because of its acid and bile resistance, strong inhibitory impact against E. coli, and high adhesion ability, the in vitro investigation revealed the value and potentiality of probiotics.

Essential oils (EO) have been gaining popularity as a result of consumer preference for natural products (Brenes and Roura, 2010). The antibacterial activity of EO against a variety of pathogenic bacteria, including both Gram-positive and Gram-negative bacteria, has been thoroughly investigated in vitro and is well established.(Ouwehand et al., 2010; Upadhyaya et al., 2013). Supplementing the ration with EO has been demonstrated to enhance humoral and cellular immunity (Lee et al., 2011; Awaad et al., 2014). In chickens, that influence host immunity gene expression (Kim et al., 2010). Among the hundreds of compounds in essential oils, carvacrol has a strong antibacterial action (Bassole and Juliani, 2012). Carvacrol has been shown to block pro-inflammatory cytokines, reduce inflammatory cell recruitment, and reduce oxidative damage (Riella et al., 2012; Guimaraes et al., 2012) .Lipopolysaccharide-injected broiler chickens’ spleens, a prior study revealed that Carvacrol may increase IL-4 gene expression while lowering cytokines such as tumor necrosis (TNF) gene expression. (Du et al., 2015). In the current study, EO elevated the level of IL-4 gene expression from 0.1914 to 0. Carvacrol may increase IL-4 gene expression while lowering cytokines such as tumor necrosis (TNF) gene expression. 4293 after challenge, and to 4.0911 before challenge, however, linearly inhibited gene expression of IL-6 from10.0561 in control positive group to 7.1900 after challenge, and to 0.8438 before challenge. Finally, the in vitro study proved the efficacy and potential of probiotics, lectins, and essential oils in the fight against E. coli. The results of the animal studies revealed that administering these immune modulatory agents alleviated the growth suppression induced by E. coli challenge, increased the growth performance, decreased E. coli reisolation rate, and improved the immunity in E. coli challenged broilers. This data suggest that probiotics, lectins, and essential oils could be employed as an alternative to antibiotics as growth promoters in broilers, especially when it comes to E. coli management.

Conclusion

Avian pathogenic E.coli is a great problem in poultry, and poultry farms as it is accused of causing respiratory, and enteric lesions, with economic losses, and difficulty to be controlled. The present study provides to some extent a safe solution to manage this problems by using lectins, probiotics, and essential oils as they have immune modulatory effects, and improve performance of the birds to overcome the E. coli infections.

Acknowledgment

The authors would like to thank the Bacteriology, Mycology and Immunology Department staff at the Faculty of Veterinary Medicine, Beni-Suef, and Cairo University for providing technical support.

Authors’ contribution

Authors’ involvement Planning the study and writing the manuscript were both responsibilities undertaken by all of the researchers. as well as approveing the final version of the article.

Conflict of interest

The authors declared that there is no conflict of interest.

References

Abd El-Mawgo A, El-Nahass E, Salama AA, EL-Sawah A, Dahshan A M, Nasef S, Ali A (2020). Efficacy of live attenuated Vaccine and Commercially\Available Lectin against Avian Pathogenic E. coli Infection in Broiler Chickens. Vet. Sci. 7: 65. https://doi.org/10.3390/vetsci7020065

Abdallah H M, Reuland EA, Wintermans B B, Al Naiemi N, Koek A, Abdelwahab A M, Ammar AM, Mohamed A A, Vandenbrouck e-Grauls CM (2015). Extended-spectrum beta-Lactamases and/or carbapenemases-producing enterobacteriaceae isolated from retail chicken meat in Zagazig, egypt. PLoS ONE. 10, e0136052. https://doi.org/10.1371/journal.pone.0128120

Ali A, AbdEl-Mawgoud A I, Dahshan A M, El-Sawah A A , Nasef SA, Ibrahim M (2019). Virulence Gene Constellations Associated with Lethality in Avian Pathogenic E. coli Recovered from Broiler Chickens. Adv. Anim. Vet. Sci. 7: 1076–1082. https://doi.org/10.17582/journal.aavs/2019/7.12.1076.1082

Awaad MH, Elmenawey M, Ahmed KA (2014). Effect of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth performance, carcass quality and gut integrity of broiler chickens. Vet. World. 7:284–90. https://doi.org/10.14202/vetworld.2014.284-290

BassoleI H, Juliani HR (2012). Essential oils in combination and their antimicrobial properties. Molecules. 17:3989–4006. https://doi.org/10.3390/molecules17043989

Brenes A, Roura E (2010). Essential oils in poultry nutrition: Main effects and modes of action. Anim. Feed Sci. Tech. 158:1–14. https://doi.org/10.1016/j.anifeedsci.2010.03.007

Coneglian JLB, Vieira SL, Berres J, Freitas DMD (2010). Responses of fast and slow growth broilers fed all vegetable diets with variable ideal protein profiles. Revist. Brasil. Zoot. 39(2):327–334. https://doi.org/10.1590/S1516-35982010000200015

Du E, Li C, Guo Y (2015). Effects of essential oils on lipopolysaccharide-induced acute-phase response in broiler chickens. Poult. Sci. 94(E-Suppl 1):11

El-Shazly DA, Nasef SA, Mahmoud F F, Jonas D (2017). Expanded spectrum beta-lactamase producing Escherichia coli isolated from chickens with colibacillosis in Egypt. Poult. Sci. 96: 2375–2384. https://doi.org/10.3382/ps/pew493

Gackowska L, Michalkiewicz J, Krotkiewski M, Helmin-Basa A, Kubiszewska I,Dzierzanowska D (2006). Combined effect of different lactic acid bacteria strains on the mode of cytokines pattern expression in human peripheral blood mononuclear cells. J. Physiol. Pharmacol. 57 Suppl. 9: 13–21

Gareau M, Sherman P, Walker W (2010). Probiotics and the gut microbiota in intestinal health and disease. Nat. Rev. Gastroenterol. Hepatol. 7:503–514. https://doi.org/10.1038/nrgastro.2010.117

Guimaraes AG, Xavier MA, de Santana MT, Camargo EA, Santos CA, Brito FA (2012). Carvacrol attenuates mechanical hyper nociception and inflammatory response. N-S Arch Pharmacol. 385:253–63. https://doi.org/10.1007/s00210-011-0715-x

He C B, Fu P, Yi X, Wei Z, Yin C, Lv W, Zhang X, Han X Cun (2014). Effectiveness of Xiang-Qi-Tang against Avian Pathogenic Escherichia coli. Pak. Vet. J. 34:127–129

Iordache F, Ionita M, Mitrea LI, Fafaneata C, Pop A (2015). Antimicrobial and antiparasitic activity of lectins.Curr. Pharm. Biotechnol. 16: 152–161. https://doi.org/10.2174/138920101602150112151907

Irwin PL, Nguyen LHT, Paoli GC, Chen CY (2010). Evidence for a bimodal\distribution of Escherichia coli doubling times below a threshold initial cell concentration. BMC Microbiol.; 10(1):207. 1471-2180-10-207 https://doi.org/10.1186/1471-2180-10-207

Jiang B, Wang X, Wang L, Lv X, Li D, Liu C, Feng Z (2019). Two-step isolation, purification, and characterization of lectin from zihua snap bean (Phaseolus vulgaris) seeds. Polymers (Basel). volume, 11,785. https://doi.org/10.3390/polym11050785

Kim DK, Lillehoj HS, Lee SH, Jang SI, Bravo D (2010). High-throughput gene expression analysis of intestinal intraepithelial lymphocytes after oral feeding of carvacrol, cinnamaldehyde, or Capsicum oleoresin. Poult. Sci. 89:68–81. https://doi.org/10.3382/ps.2009-00275

Konstantinov SR, Smidt H, de Vos WM, Bruijns SC, Singh SK, Valence F, Molle D, Lortal S, Altermann E, KlaenhammerTR, van Kooyk Y (2008).  layer protein A of Lactobacillus acidophilus NCFM regulates immature dendritic cell and T cell functions. Proc. Natl. Acad. Sci. USA. 105: 19474–19479. https://doi.org/10.1073/pnas.0810305105

Lee SH, Lillehoj HS, Jang SI, Lee KW, Bravo D, Lillehoj EP (2011). Effects of dietary supplementation with phytonutrients on vaccine-stimulated immunity against infection with Eimeria tenella. Vet. Parasitol. 181:97–105/ https://doi.org/10.1016/j.vetpar.2011.05.003

Liu F, Li G, Wen K, Bui T, Cao D, Zhang Y, Yuan L (2010). Porcine small intestinal epithelial cell line (IPEC-J2) of rotavirus infection as a new model for the study of innate immune responses to rotaviruses and probiotics. Viral Immunol. 23: 135–149. https://doi.org/10.1089/vim.2009.0088

Markowski-Grimsrud CJ, Schat KA (2003). Infection with chicken anaemia virus impairs the generation of pathogen-specific cytotoxic T lymphocytes. Immunology. 109(2):283-94. https://doi.org/10.1046/j.1365-2567.2003.01643.x

Nagano T, Kitahara R, Nagai S (2012). An attenuated mutant of avian pathogenic Escherichia coli serovar O78:A possible live vaccine strain for prevention of avian colibacillosis. Microbiol. Immunol. 56: 605–612. https://doi.org/10.1111/j.1348-0421.2012.00482.x

 Nielsen OL, Jensenius J C, Jørgensen PH, Laursen SB (1999). Serum levels of chicken mannan-binding lectin (MBL) during virus infections; indication that chicken MBL is an acute phase reactant. Vet. Immunol. Immunopathol.  70: 309-316. https://doi.org/10.1016/S0165-2427(99)00090-2

Norup L, Dalgaard T, Friggens N, Sørensen P, Juul-Madsen H (2009). Influence of chicken serum mannose-binding lectin levels on the immune response towards Escherichia coli. Poult. Sci.  88: 543-553. https://doi.org/10.3382/ps.2008-00431

Ouwehand AC, Tiihonen K, Kettunen H, Peuranen S, Schulze H, Rautonen N. (2010). In vitro effects of essential oils on potential pathogens and beneficial members of the normal microbiota. Vet. Med-Czech. 55:71–8 https://doi.org/10.17221/152/2009-VETMED

Parente E, Ricciardi A (1999). Production, recovery and purification of bacteriocins from lactic acid bacteria. Appl. Microbiol.Biot. 52:628–638. https://doi.org/10.1007/s002530051570

Park H J, Hong J H, Kwon H J, Kim Y, Lee K H, Kim J B (2010). TLR4-mediated activation of mouse macrophages by Korean mistletoe lectin-C (KML-C). Biochem. Biophys. Res. Commun. 396: 721–725. https://doi.org/10.1016/j.bbrc.2010.04.169

Projahn M, Pacholewicz E, Becker E, Correia-Carreira, G, Bandick N, Kaesbohrer A (2018). Reviewing interventions against enterobacteriaceae in broiler Processing: Using old techniques for meeting the new challenges of ESBL E. coli? Biomed. Res. Int. 7309346. https://doi.org/10.1155/2018/7309346

Rawiwet V, Chansiripornchai N (2009). The efficacy of Escherichia coli aroa-live vaccine in broilers against avian E. coli serotype O78 infection. Thai J. Vet. Med. 39: 337–342.

Riella KR, Marinho RR, Santos JS, Pereira-Filho RN, bCardoso, JC, AlbuquerqueJunior RL (2012). Anti-inflammatory and cicatrizing activities of thymol, amonoterpene of the essential oil from Lippia gracilis, in rodents. JEthnopharmacol. 143:656–63. https://doi.org/10.1016/j.jep.2012.07.028

She Q, Ng T, Liu W (1998). A novel lectin with potent immunomodulatory activity isolated from both fruiting bodies and cultured mycelia of the edible mushroom Volvariella volvacea. Biochem. Biophys. Res. Commun. 247; 106–111. https://doi.org/10.1006/bbrc.1998.8744

Suzuki K, Okada H, Itoh T, Tada T, Mase M, Nakamura K, Kubo M, Tsukamoto K (2009). Association of increased pathogenicity of asian H5N1 highly pathogenic avian influenza viruses in chickens with highly efficient viral replication accompanied by early destruction of innate immune responses. J. Virol. p. 7475–7486. https://doi.org/10.1128/JVI.01434-08

Takahashi K (2011). Mannose-binding lectin and the balance between immune protection and complication. Expert Rev. Antiinfect. Ther.  9; 1179-1190. https://doi.org/10.1586/eri.11.136

Tayal V, Kalra B S (2008). Cytokines and anti-cytokines as
therapeutics-An update. Eur. J. Pharmacol. 579:1–12.

Ulrich-Lynge SL, Dalgaard TS, Norup LR, Song X, Sørensen P, Juul-Madsen HR (2015). Chicken mannose-binding lectin function in relation to antibacterial activity towards Salmonella enterica. Immunobiology.  220: 555-563. https://doi.org/10.1016/j.imbio.2014.12.007

Upadhyaya I, Upadhyay A, Kollanoor-Johny A, Darre MJ, Venkitanarayanan K. (2013). Effect of plant derived antimicrobials on Salmonella Enteritidis adhesion to and invasion of primary chicken oviduct epithelial cells in vitro and
virulence gene expression. Int. J. Mol. Sci. 14:10608–25. https://doi.org/10.3390/ijms140510608

van Holten J K, Reedquist P, Sattonet-Roche T J, Smeets C ,Plater-Zyberk M J, Vervoordeldonk Tak PP (2004). Treatment with recombinant interferon-beta reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis. Arthritis Res. Ther. 6:R239–R249. https://doi.org/10.1186/ar1165

Wade B, Key burn A (2015). The true cost of necrotic enteritis. World Poult. 2015;31:
16–7.

Wang J, Tang P, Tan D, Wang L, Zhang S, Qiu Y, Dong R, Liu W, Huang J, Chen T (2015). The Pathogenicity of Chicken Pathogenic Escherichia coli is Associated with the Numbers and Combination Patterns of Virulence-Associated Genes. Open J. Vet. Med. 05: 243–254. https://doi.org/10.4236/ojvm.2015.512033

Wang S, Peng Q , Jia H M, Zeng XF, Zhu JL, Hou CL, Liu X F, Yang J, Qiao SY (2017). Prevention of Escherichia coli infection in broiler chickens with Lactobacillus plantarum B1. Poult. Sci. https://doi.org/10.3382/ps/pex061

Yuan JS, Reed A,Chen F, StewartCN (2006). statical analysis of real-time PCR data. BMC Bioinformat.7:85. https://doi.org/10.1016/j.csda.2005.11.017

Zeuthen LH, Christensen HR, Frøkiaer H (2006). Lactic acid bacteria inducing a weakinterleukin-12 and tumor necrosis factor alpha response in human dendritic cells inhibit strongly stimulating lactic acid bacteria but act synergistically with gram-negative bacteria. Clin. Vacc. Immunol. 13: 365–375. https://doi.org/10.1128/CVI.13.3.365-375.2006

Zhang F, Zeng X, Yang F, Huang, Z, Liu H, Ma X, Qiao ,S . (2013). Dietary N-carbamylglutamate supplementation boosts intestinal mucosal immunity in Escherichia coli challenged piglets. PLOS ONE. 8: e662806 https://doi.org/10.1371/journal.pone.0066280

Zhang, W., Van Eijk, M., Guo, H., Van Dijk, A., Bleijerveld, O.B., Verheije, M.H., Wang, G., Haagsman, H.P., Veldhuizen, E.J (2017). Expression and characterization of recombinant chicken mannose binding lectin. Immunobiology . 222, 518-528. https://doi.org/10.1016/j.imbio.2016.10.019

Zulkifli I, Abdullah N. M. Azrin M, Y. W. Ho MY (2000). Growth performance and immune response of two commercial broilerstrains fed diets containing Lactobacillus cultures and oxytetracycline under heat stress conditions. Brit. Poult. Sci. 41:593–597. https://doi.org/10.1080/713654979