Research Article

Risk Mitigation of E. coli O157 and its Intimin (eaeA) and Shiga Toxin (stx2) Gene Expression in Chilled Chicken Fillets Using Chitosan Nanoparticle Loaded with Lysozyme

Aalaa S. Saad1*, Amira A. Elokle2, Dalia Y. Youssef2, Neven M. Omara2, Samr Kassem3

1Biotechnology Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; 2Reference Lab for Examination of Food of Animal Origin, Food Hygiene Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; 3Nanomaterials Research and Synthesis Unit, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Giza, Egypt.

Received | December 01, 2023; Accepted | January 27, 2024; Published | February 14, 2024

*Correspondence | Aalaa S. Saad, Biotechnology Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; Email: alaa.samir87@yahoo.com

Citation | Saad AS, Elokle AA, Youssef DY, Omara NM, Kassem S (2024). Risk mitigation of E. coli O157 and its intimin (eaeA) and shiga toxin (stx2) gene expression in chilled chicken fillets using chitosan nanoparticle loaded with lysozyme. Adv. Anim. Vet. Sci., 12(4):603-613.

DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.4.603.613

ISSN (Online) | 2307-8316

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Chicken meat is popular in the consumer market due to its quick and easy preparation and affordable prices, making it a preferred choice for consumers adapting to modern lifestyles. The consumption of poultry meat, especially chicken, continues to rise globally, particularly in developing countries where cultural or religious restrictions do not exist (Kralik et al., 2018). However, chicken carcasses promote the growth of foodborne microorganisms, including Salmonella, E. coli, Campylobacter, and Staphylococcus aureus, which are significant causes of human foodborne outbreaks (Bhaisare et al., 2012).

E. coli O157 is a major foodborne pathogen responsible for outbreaks and severe diseases such as hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS) (Abuladze et al., 2008). Shiga toxin is the main virulence component of Shiga toxin-producing E. coli (STEC), which causes immunopathologies such as HC and HUS. However, without the adherence elements, stx2 alone is unlikely to cause severe disease. It has been discovered that STEC strains possess multiple genes that enable attachment, colonization, production, and secretion of toxin proteins. The eae gene, located on the pathogenicity island LEE (locus of enterocyte effacement), encodes the intimin protein, which is crucial for colonization in most STEC strains (Yang et al., 2020).

Therefore, microbial contamination during poultry meat processing is essential to the procedures used in processing. When processing poultry, Poultry carcasses and cuts have been found to effectively reduce contamination with food-borne pathogens through the use of various decontamination techniques, including physical, chemical, and biological methods. As consumer awareness of the dangers of man-made chemicals in food has grown, the food industry is keenly interested in using natural compounds that have the potential to produce foods that are extremely safe. A new challenge in poultry processing is to provide effective food preservative materials to meet consumer demand for natural and organic products, especially in the area of microbiological safety (El-Khawas et al., 2020; Abd El-Fatahand Saad, 2020). Previous studies found E. coli O157 in chicken fillets (Ali et al., 2010).

Lysozyme belongs to the hydrolase family and is a small, monomeric protein that remains unaffected by a wide range of pH values and temperatures. Besides its antibacterial activities, lysozyme is widely distributed and excreted by plants and animals and possesses anti-inflammatory, anti-cancer, and analgesic properties. Numerous studies have shown that the enzyme lysozyme is a peptide glycan N-acetyl muramoyl hydrolase, commonly known as muramidase, which can lyse bacterial cell walls (Ahmed and Al-Mousawi, 2021).

Research carried out in vivo has revealed the antimicrobial characteristics of lysozyme. Li et al. (2014) found that adding lysozyme to nano-fibrous mats effectively inhibited the growth of S. aureus and E. coli. Because of its biological activity, lysozyme and its complex are widely used in food packaging, food preservatives, and wound dressing (Yuan et al., 2013).

Chitosan (CS), a linear polysaccharide derived from chitin through demineralization and deproteinization, has a wide range of applications in both medicine and agriculture. The exceptional biological properties of CS, such as its biocompatibility, biodegradability, non-toxicity, and antibacterial activity, have attracted significant attention in various fields (Chandrasekaran et al., 2020) and attracted interest in several disciplines. Compared to their original counterparts, the physical properties of nanoparticles (NPs) have significantly changed due to their smaller size. CS-NPs combine the advantages of NPs, such as their small size, increased surface area, quantum size effects, and the properties of CS (Divya et al., 2017).

Reverse transcription polymerase chain reaction (RT-PCR) is the preferred method for analyzing mRNA expression from various sources due to its high sensitivity (Kim et al., 2021). It can determine gene expression from a known amount of cDNA or RNA and fold changes. RNA must be converted to cDNA to be detectable in qPCR since only DNA is detectable in PCR. Furthermore, cDNAs are more stable during the dilution phase compared to RNA. However, this phase is susceptible to quantification errors of unknown magnitude due to the possibility of varying reverse transcription efficiency between samples. In comparison, cDNA is superior to RNA for qPCR results in terms of quantification accuracy (Lu et al., 2012).

This study aimed to synthesize chitosan nanoparticles (CS-NPs) and load them with lysozyme (CS-LZ-NPs). Moreover, it evaluated the antibacterial activity of the synthesized CS-NPs and CS-LZ-NPs against E. coli O157 in chilled chicken fillets and the relative expression of eaeA and stx2. To our knowledge, this is the first study to determine the antimicrobial activity of CS-NPs and CS-LZ-NPs against E. coli O157 in preserved chicken fillets under refrigerated conditions and the expression of target toxin genes (intimin and Shiga).

Materials and Methods

Bacterial strains

The strain of E. coli O157 (AHRI/301) used in this experiment was obtained from the Department of Bacteriology, AHRI, ARC. It was identified using the automated VITEK® 2 system and antisera and stored at -80 °C. The frozen (glycerol stock) E. coli O157 culture was activated by inoculation into Tryptic Soya Broth (TSB; Biolife) and incubated overnight at 37 °C for 24 h to reach a final concentration of approximately 108 CFU/ml, as determined by plating serial dilutions on Sorbitol MacConkey Agar (LAB M). Serial dilution was performed on sterile PBS to give approximately 106 CFU/ml in the inoculated solution.

Preparation of CS-NPs and chitosan nanoparticles loaded with lysozyme (CS-LZ-NPs)

Chitosan, with a molecular weight of 100-300 kDa and a degree of deacetylation of 93–95%, was obtained from Lanxess, Germany. Sodium tripolyphosphate (TPP), anhydrous and ultra-pure, was obtained from Oxford, India. Egg white lysozyme (20,000 U/mg protein) was purchased from Bio Basic Inc., Canada. Sodium hydroxide (1 M) was obtained from Sigma Aldrich, USA. CS-NPs were prepared as described by (Piras et al., 2014) with modifications. For empty CS-NPs, CS (1 mg/ml) was dissolved in acetic acid (1% V/V), and TPP (1 mg/ml) was dissolved in deionized water. Nanoparticles were obtained directly after dropwise titration of 20 ml of TPP to 50 ml of CS solution with continuous magnetic stirring for 2 h, pH adjustment to 4 using Na OH (1 M), and then centrifugated for 30 min. For CS-LZ-NPs, different concentrations (0.5, 1, 1.5, 2, and 2.5 mg/ml) of lysozyme were mixed and titrated with TPP in CS solutions using the same method to synthesize and purify empty CS nanoparticles.

Characterization of synthesized NPs

The particle size and surface charge of prepared bare CS-NPs and CS-LZ-NPs (2.5 mg/ml) were characterized by a NANOTRAC-WAVE II Zeta-Sizer (MICROTRAC, USA). The morphological investigation of synthesized NPs was performed using TEM (JEM-2100, JEOL). The UV analysis was performed using a UV-visible spectrophotometer (SHIMADZU-2600i, USA).

Cytotoxicity assay

An SRB assay using oral epithelial cells (OEC) was used to assess cell viability after treatment with various concentrations of prepared empty CS-NPs and CS-LZ-NPs (50–450 µg/ml), according to the method described by (Allam et al., 2018).

Encapsulation efficiency (EE%) and in vitro release study

The loading capacity and EE percentage of CS-LZ-NPs were measured at pH 4 with different lysozyme concentrations (0.5, 1, 1.5, 2, and 2.5 mg/ml), according to (Wu et al., 2017). The UV-visible spectrophotometer was used to measure the lysozyme concentration in the supernatant of the solution, and EE% was calculated as the amount of lysozyme retained in the CS-LZ-NPs compared to the total amount of lysozyme used in the synthesis protocol. The percentage of in vitro release in phosphate-buffered saline (PBS, pH 7.4) was determined by CS-LZ-NPs prepared with an enzyme concentration of 2.5 mg/ml at pH 4, following the method described by (Wu et al., 2017). A UV spectrophotometer was used to measure the release over time within 350 min.

Antimicrobial activity of CS-NPs and CS-LZ-NPs

The broth microdilution assay was performed to determine the MIC values of CS-NPs and CS-LZ-NPs, following the method described by CLSI. Two-fold serial dilutions of the CS-NPs and CS-LZ-NPs (up to 5 concentrations ranging from 5 to 0.312 mg/ml) with an enzyme concentration of 2.5 mg/ml in CS-LZ-NPs were set up in a microdilution plate. Each microwell received an equal volume of bacterial culture at a final concentration of 1×105 CFU/ml. Identical amounts of bacterial culture were added to saline as a positive control with no additive. The plate was kept at 37 °C for 24 h, and 100 µL of each well was plated on the correct agar medium. Colonies were counted after incubation.

Preparation of chicken fillets

The chicken breast meat, which was examined and found to be free of E. coli O157, was sliced, and the chicken fillets were divided into six groups as illustrated in detail in Figure 1.

Inoculation procedures

E. coli O157 cells were grown in a stationary phase in tryptic soy broth (TSB; Biomark Laboratories). The chicken fillets were inoculated with an E. coli O157 solution.

Group 1 fillets were inoculated with E. coli O157, immersed in CS-NPs, and stored in the refrigerator (chill preservation).

Group 2 fillets were inoculated with E. coli O157, treated with CS-LZ-NPs, and preserved in the refrigerator (chill preservation).

Group 3 fillets were inoculated with E. coli O157 and stored in the refrigerator (chilled preservation) without CS-NPs or CS-LZ-NPs (control).

Group 4 fillets were treated with CS-NPs but not inoculated with E. coli O157.

Group 5 fillets were treated with CS-LZ-NPs but not inoculated with E. coli O157 for sensory evaluation of product technology.

E. coli O157 viable counts

Fillets from each group were sampled at 2 h on day 0, then every 3 days for all groups till spoilage signs. All tests were performed in triplicate. A total of 25 g of each sample was homogenized using a Stomacher (Seward Stomacher 80 Biomaster, England) with 225 ml of saline (CHEM LAB NV) to achieve a 1:10 dilution. Ten-fold serial dilutions of the homogenate were prepared using 0.1% sterile peptone water (LAB M). One milliliter of the sample suspension was aseptically transferred to the dried surface of three sorbitol MacConkey agar plates (LAB M) and spread by a sterile curved glass spreader stick. The plates were held in an upright position until the inoculum was absorbed by the agar and then incubated at 37 °C for 24 h to determine the total number of E. coli O157 (by summing the E. coli O157 in the three TBX-Agar (Biolife) and multiplying by the sample dilution factor). The reduction percentages (R%) were calculated according to the following equation:

R% = (control count − treatment count/control count) × 100 (Elsherif and Shrief, 2021)

 

Gene expression assay

Extraction

The EasyPure® RNA kit was used to extract the mRNA, following the instructions provided in the pamphlet. Specifically, 200 µL of the prepared sample was mixed with 20 ml of proteinase K. Then, 200 ml of binding buffer 5 containing carrier RNA was applied and stirred for 15 s. The mixture was then incubated at 56 °C for 15 min, and 250 ml of absolute ethanol was added. The sample was then vortexed for 15 s and incubated at ambient temperature (15–25 °C) for 15 min. The mixture was then transferred to a spin column tube and centrifuged at 12,000 g for 60 s, with the flow-through liquid being discarded. The column was washed with 500 ml of washing buffer, and the process was repeated. The spin-column tubes were then transferred to a clean 1.5 ml micro centrifuge tube with 20 ml RNase-free water added to the center of the column. The sample was then incubated for 60 s at ambient temperature and centrifuged for 60 s at 12,000 rpm. The obtained RNA was stored at -80 °C until use.

Complementary DNA synthesis

Using EasyScript® FirstStrand cDNA Synthesis SuperMix, 5 µg of the extracted RNA was mixed with 1 µL of anchored oligo (dT) 18 primer, 10 µL of 2XES reaction mix, 1 µL of EasyScript® RT/RI enzyme mix, and RNase-free water until the volume reached 20 µL. The mixture was then incubated for 15 min at 42 °C.

Real-time PCR

The oligonucleotide primers used in this study (Table 1) were synthesized by Metabion® International AG. Data acquisition and analysis were performed using real-time PCR version 2.2.2 (Applied Biosystems). The amplification for Rt-PCR was carried out with TransStart Green qPCR SuperMix in a total volume of 20 μL, consisting of 1 μL of template DNA, 0.4 μL of each forward and reverse primer, 10 μL of 2X TransStart® Green qPCR SuperMix, 0.4 μL of passive reference dye (50X), and finally, 7.8 µL of double-distilled water. The cycle thresholds of the target genes (eaeA and stx2) belonging to E. coli were obtained from samples containing CS-NPs, CS-LZ-NPs, and blanks (control) and compared and normalized to the housekeeping gene (GAPDH). The fold changes in the target genes were determined using the 2-ΔΔCt method of the formula, as described by (Pfaffl, 2001).

 

Table 1: Primers used for the real-time polymerase chain reaction.

Primer	Sequence (5-3)	Cycling conditions
GAPDH	AAGTTTGCACTTCCGTGTTC	one cycle at 95°C for 2 min, 40 cycles at 95°C for 5 s, and 60°C for 10 s.	Khatib et al., 2017
	CGTTGTCGTACCAGGATACC
Stx2	CTGTGGCCGTTATACTGAAT
	GTCGCCAGTTATCTGACATT
eaeA	TGCTGGCATTTGGTCAGGTC		Chassagne et al., 2009
	CGCTGA(AG)CCCGCACCTAAATTTGC

 

Sensory evaluation of chicken fillets containing CS-NPs and CS-LZ-NPs

The investigators in this study were 14 specialists from the staff of the Animal Health Research Institute’s Food Hygiene Department, ARC. The study evaluated ready-to-eat chicken fillets with CS-NPs, ready-to-eat chicken fillets with CS-LZ-NPs, and blank (control) samples that did not contain CS-NPs or CS-LZ-NPs. The most frequently cited descriptors included color, taste, aroma, and acceptance. The specialists were asked to rank samples according to their intensity for each of the four descriptors. There was a 9-point hedonic scale where 9 indicated an extreme aversion to fillets compared to fillets without chitosan or lysozyme (Kim et al., 2015). The examiner considered the sample rejected if the scores were less than five.

Statistical analysis

All analyses were performed in triplicate. Data were analyzed using statistical Excel (Microsoft, 2016). Significant differences between the results were examined by a Student’s t-test at p ≤ 0.05. The data were expressed as means ± SD. To assess the comparative expression of target genes, the 2−ΔΔCT method was utilized in comparison with the control group.

RESULTS AND DISCUSSION

Characterization of CS-NPs and CS-LZ-NPs

Zetasizer determined particle size, polydispersity index (PDI), and surface charge (Fig. 2A1, A2) at pH 4. The average particle size was 250 nm, and 281.4 nm for CS-NPs (5 mg/ml) and CS-LZ-NPs (lysozyme concentration 2.5 mg/ml), and the polydispersity index (PDI) for CS-NPs and CS-LZ-NPs was 0.09 and 0.58, respectively. Surface charges were +20.3 and +29.2 mV, respectively. The ionotropic gelation technique using tripolyphosphate (TPP) as a crosslinker was employed to synthesize CS-NPs due to its perfect gelation ability and non-toxic nature (Koukaras et al., 2012). The chitosan to TPP concentration of 1:1 was used to control the physicochemical properties of the prepared nanoparticles. The interaction between cationically charged chitosan and TPP, which has a high-density negative charge, leads to gel formation with improved mechanical resistance. The concentration of chitosan to TPP affects the mechanical strength of the formula and the size distribution of the nanoparticles due to the electrostatic interaction between both molecules (Calvo et al., 1997). The nanoparticles obtained in this study exhibited a narrow size distribution, increasing as the concentration percentage increased (Deng et al., 2006). The positive charge observed in the Zetasizer analysis indicated the presence of positive amino groups on the particle surface (Wu et al., 2017). TEM imaging further confirmed the uniformity and small size of the nanoparticles (Fig. 2B1, B2). The CS-NPs and CS-LZ-NPs appeared as spherical, solid, consistent particles without agglomeration, ranging in size from 13.1 to 17.6 nm and 15.6 to 19.5 nm, respectively. UV analysis of CS-NPs, CS-LZ-NPs, and lysozyme was performed to study the complex pattern between CS-NPs and lysozyme (Fig. 2C). The absorption peaks of CS-LZ-NPs and lysozyme were recorded at 285 and 280 nm, respectively. In comparison, the CS-NPs showed a weak absorption peak at 280 nm. The absorption peak at 280 nm is usually related to the amino acid composition of the lysozyme, which is present in the presence of CS-NPs at 285 nm. This higher excitation revealed binding between lysozyme and CS-NPs, resulting in an increase in optical density compared to free lysozyme (Wu et al., 2017).

NPs cytotoxicity evaluation

The cytotoxicity of the synthesized CS-NPs and CS-LZ-NPs was assessed using an OEC cell line by SRB assay at concentrations ranging from 50 to 450 µg/ml. In the SRB assay, CS-NPs and CS-LZ-NPs showed no toxicity at concentrations ranging from 50-450 µg/ml for both nanoparticles, indicating that cells had the same characteristics as control cells. For CS-NPs, cell viability ranged from 99.82% to 92.5% at concentrations ranging from 50 to 450 g/ml. However, in the case of CS-LZ-NPs, cell viability ranged from 101.82% to 95.23% at concentrations ranging from 50 to 450 g/ml, as shown in Figure 3A. The higher survival rates of both nanoparticles are related to the biocompatibility and biodegradability of chitosan and the non-toxic property of lysozyme (Wu et al., 2017), which exhibits multiple beneficial biological activities. Lysozyme, derived from egg white, has also been recognized by the US Food and Drug Administration (FDA) and approved for food preservation as safe for human health (Khorshidian et al., 2022).

 

Encapsulation efficiency (EE%) and in vitro release study

The EE% of CS-LZ-NPs at pH 4 was measured with different concentrations of lysozyme (0.5, 1, 1.5, 2, and 2.5 mg/ml) (Fig. 3B) in the supernatant of the solution by a UV-visible spectrophotometer. The present study has shown that, in agreement with that of (Wu et al., 2017), there is a direct correlation between the concentration of loaded lysozyme and EE% at pH 4. The maximum EE% value of 85% was observed at a lysozyme concentration of 2.5 mg/ml rather than at lower concentrations of loaded lysozyme. CS-LZ-NPs formula with an enzyme concentration of 2.5 mg/ml, prepared at pH 4, was selected for the in vitro detection of percent release in PBS (pH 7.4) by UV spectrophotometer for 350 min. The current results showed that the maximum release percentage was 18% after 300 min and dropped to only 16% after 350 min, indicating 82% and 84% retention of lysozyme in the CS-LZ-NPs formula, respectively, for 350 min (Fig. 3C). These results demonstrated the ability of CS-LZ-NPs to

 

prolong the release percentage and to be entrapped in the mixture for an extended period, which might be beneficial for antibacterial efficacy when used in the field of food preservation. The percentage of the release of lysozyme from CS-NPs is influenced by many factors, such as the concentration of lysozyme, the size of the CS-NPs, and the pH of the release medium (Wu et al., 2017; Dragan et al., 2016).

Antimicrobial efficacy of CS-NPs and CS-LZ-NPs on E. coli O157

The bactericidal activities of CS-NPs and CS-LZ-NPs against the E. coli O157 strain were recorded. CS-LZ-NPs with an enzyme concentration of 2.5 mg/ml showed bactericidal activities against E. coli O157 at concentrations of 2.5, 1.25, 0.625%, and 0.312 mg/ml each. CS-NPs with a CS concentration of 5 mg/ml exhibited bactericidal activities only at 5 and 2.5 mg/ml concentrations. These concentrations were selected based on the results reported by (Wu et al., 2017), who observed complete basement membrane damage with irregularity of E. coli cell shape and leakage of cytoplasmic contents at a concentration of 1 mg/ml CS-Lys-NPs. The minimum inhibitory concentration (MIC) values of CS-NPs were 2.5 mg/ml. However, the CS-Lys-NP concentration of 0.312 mg/ml was sufficient to elicit complete inactivation of E. coli, indicating the increased sensitivity of E. coli when lysozyme has been integrated into CS-NPs. These values are consistent with various studies confirming the antimicrobial activity of CS nanoparticles against E. coli at lower concentrations (Younes et al., 2014). A complete reduction (R%) in E. coli O157 occurred on the third day with CS-LZ-NPs and on the seventh day with CS-NPs (Table 2).

 

Table 2: Reduction percentages (R %) of E. coli O157 after inoculation in chicken fillets during refrigerated storage.

Time of storage	CS-NPs	CS-LZ-NPs
Zero day	0.96	0.98
3rd day	0.92	1.00
7th day	1.00	1.00
10th day	1.00	1.00

 

Legend: The numbers indicate the R%.

 

Experimental outcomes

Figure 4 shows the influence of CS-NPs and CS-LZ-NPs on the viable count of E. coli O157 in chicken fillets at chilled preservation, expressed as log CFU/g. The initial counts (after 2 hours on day 0) of CS-NP-treated chicken fillets (Group 1), CS-LZ-NP-treated chicken fillets (Group 2), and control (Group 3) were 5.3 log CFU/g, 4.95 log CFU/g, and 6.7 log CFU/g, respectively. Consequently, the number of viable E. coli O157 in fillets treated with CS-NPs and CS-LZ-NPs gradually decreased significantly (p < 0.05) during chilling compared to the control to 2.9 log CFU/g in the CS-NP group and 1.2 log CFU/g (19 CFU/g) in the CS-LZ-NP group on the tenth day of preservation. Intriguingly, CS-NPs and CS-LZ-NPs not only increased the shelf life of the chicken fillet but also reduced the risk of E. coli O157 below the infectious dose (50-100 colony forming units) (CFU/g or ml), as mentioned by (O’flynn et al., 2004). Additionally, there was a significant difference between the CS-NPs treated group and the CS-LZ-NPs treated group on all experimental days (p < 0.05). Naturally sourced nanoparticles have received significant attention in food preservation and pharmaceutical products. Our study used CS-LZ-NPs as an antimicrobial agent against E. coli O157 at a 5 mg/ml dose with a lysozyme concentration of 2.5 mg/ml and showed higher potency than CS-NPs. The antimicrobial effect of chitosan depends on various factors, such as the electrostatic interaction between the cationically charged chitosan particles and the anionically charged bacterial cell wall, the degree of deacetylation, the molecular weight, and pH of the media (Yilmaz, 2020). The antimicrobial effect of lysozyme is referred to as the enzymatic hydrolytic role of lysozyme on the glycosidic bonds of peptidoglycan chains between NAM (N-acetylmuramic acid) and NAG (N-acetylglucosamine); the non-enzymatic role is due to the electrostatic interaction between positively charged lysozyme and negatively charged teichoic acids in the cell membrane of Gram-positive bacteria and the phospholipids of the bacterial membrane (Primo et al., 2018).

 

The effect of lysozyme on Gram-negative bacteria is weak due to the presence of a thin peptidoglycan layer in the cell membrane (7-8 nm) in the case of E. coli, the absence of teichoic acids, and the presence of phospholipids, lipopolysaccharides, and lipoproteins in the outer membrane, which act as a barrier restricting the ability of lysozymes to target cellular peptidoglycan (Khorshidian et al., 2022). Modifying lysozyme through denaturation or conjugation with other compounds, mainly polysaccharides, is advisable to enhance lysozyme’s antimicrobial function against gram-negative bacteria (Vilcacundo et al., 2018). The synergistic effect between one of the most abundant linear polysaccharides from a natural source, such as chitosan and lysozyme, is effective against E. coli O157 at a low 1 mg/ml concentration, as reported by (Wu et al., 2017). Chitosan enhances the hydrolytic effect of lysozyme on peptidoglycan chains and increases the permeability of lysozyme, resulting in cell membrane disruption depending on the higher positive charge on the particle surface with the higher PDI of synthesized CS-LZ-NPs, which opens the cell barriers to lysozyme, optimizing the antimicrobial efficacy up to complete cell lysis and death (Khorshidian et al., 2022).

 

Results from the assay on the relative expression of E. coli O157 eaeA and stx2 genes in chicken fillets containing sub inhibitory levels of CS-NPs and CS-LZ-NPs, when preserved by chilling, are presented in Figure 5. The expression of both genes was significantly reduced (p < 0.05) in the treated groups compared to the untreated (control) group. Furthermore, the CS-LZ-NPs group showed more significant downregulation of gene expression than the CS-NPs group (p < 0.05). Notably, on day 0, the relative expression of the eaeA gene was 0.82 and 0.6 in the CS-NPs and CS-LZ-NPs groups, respectively, while on the tenth day, the expression levels were 0.5 in the CS-NPs group and 0.3 in the CS-LZ-NPs group. On day 0, the relative expression of the stx2 gene in the CS-NPs group was 0.81, while in the CS-LZ-NPs group, it was 0.56. It further decreased until the tenth day, reaching 0.48 in the CS-NPs group and 0.41 in the CS-LZ-NPs group. The mechanism by which CS affects gene expression in bacterial cells is via its ability to cross the membrane and adsorb onto DNA molecules, thereby preventing RNA transcription from DNA. Therefore, the physical properties of CS, such as its molecular weight and degree of deacetylation, play a crucial role in its antimicrobial activity (Benhabiles et al., 2012).

 

The results of the sensory evaluation of chicken fillets treated with CS-NPs and CS-LZ-NPs are presented in Figure 6. The evaluations included color, taste, aroma, and overall acceptability, with high scores recorded for chitosan-treated fillets (8.5, 8, 8.5, and 8.5, respectively) and chitosan and chitosan lysozyme-treated fillets (8.5, 8, 8, and 8, respectively). The treatment of chicken fillets with either CS-NPs or CS-LZ-NPs did not significantly affect the average score of taste, color, aroma, and overall product acceptability compared to chicken fillets without chitosan and lysozyme. This finding is consistent with that reported by (Eldaly et al., 2018), who found that the application of chitosan coating on chicken fillets improved sensory properties during refrigerated storage, and (Kijowski et al., 2013), who reported that chicken samples exposed to lysozyme and stored under cold storage conditions did not differ qualitatively from fresh samples. Incorporating LZ into CS-NPs increased down-regulation activity compared to CS-NPs without lysozyme. The average zeta potential of CS-Lys-NPs increased due to the cooperation between lysozyme and CS-NPs via the NH and OH groups and the consumption of lysozyme in CS-NPs. Due to their higher surface charge density and more significant affinity for bacterial membranes, CS-Lys-NPs are more effective in down-regulating the activity of bacterial gene expression against E. coli (Rabea et al., 2003).

CONCLUSION and Recommendation

The results showed that the nanoparticles could extend the shelf life of chicken fillets for ten days and reduce the bacterial counts of E. coli O157 to below the infectious dose. This was achieved by downregulating the relative expression of the eaeA and stx2 genes, each by 0.8 in the CS-LZ-NPs group on day 10 of preservation. Overall, this study’s findings suggest that using CS-LZ-NPs can positively impact the food industry and food hygiene by extending the shelf life of chilled chicken fillets and controlling microbial contamination. Therefore, we recommend the use of CS-LZ-NPs for preserving chicken fillets in the refrigerator.

Based on the findings of this study, it can be concluded that the use of CS-LZ-NPs can have a positive impact on the food industry and food hygiene. By extending the shelf life of chilled chicken fillets and controlling microbial contamination, CS-LZ-NPs can help preserve chicken fillets in the refrigerator. Therefore, we recommend the application of CS-LZ-NPs for this purpose.

Limitations and future directions

In the present study, the antimicrobial activity of CS-NPs and CS-Lys-NPs was evaluated against E. coli O157 and their activity on the relative expression of the eaeA and stx2 genes.

We look forward to investigating the activity of CS-Lys-NPs on the relative expression of other toxin genes, such as fimA, ompA, etc. As well, additional research is necessary to ensure that CS-Lys-NPs is considered a healthy product and does not compromise consumer health.

Acknowledgments

Not applicable.

Novelty Statement

To our knowledge, this is the first study that has investigated the antimicrobial activity of CS-NPs and CS-LZ-NPs against E. coli O157 in preserved chicken fillets under refrigerated conditions and the expression of target toxin genes (intimin and Shiga). The effectiveness of lysozyme against gram-negative bacteria is limited due to the presence of a thin layer of peptidoglycan in the cell membrane, the absence of teichoic acids, and the presence of phospholipids, lipopolysaccharides, and lipoproteins in the outer membrane. These factors act as a barrier that limits the ability of lysozymes to reach the cellular peptidoglycan. To enhance the antimicrobial function of lysozyme against gram-negative bacteria, it is recommended to conjugate lysozyme with other compounds such as polysaccharides.

Author’s Contribution

AS: Designed the experiment and the gene expression calculation.

AE, DY and NO: Performed the bacteriological work of the investigation.

SK: performed the preparation and characterization of nanoemulsions.

All authors participated in writing and revising the entire manuscript.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abd El-fatah SS, Saad AS (2020). Study on dispersal of Escherichia coli and Salmonella enterica in retail beef and chicken meat. Int. J. Vet. Sci. 9: 309-12.

Abuladze T, Li M, Menetrez MY, Dean T, Senecal A, Sulakvelidze A (2008). Bacteriophages reduce experimental contamination of hard surfaces, tomato, spinach, broccoli, and ground beef by Escherichia coli O157:H7. Appl. Environ. Microbiol., 74: 6230-6238. https://doi.org/10.1128/AEM.01465-08

Afify SA, Shaltout F, Mohammed IZ (2020). Detection of E. coli O157 and Salmonella species in some raw chicken meat cuts in Ismailia province, Egypt. Benha Vet. Med. J., 39(1): 101-104. https://doi.org/10.21608/bvmj.2020.38391.1239

Ahmed SA, Al-Mousawi AJ (2021). Preparation of lysozyme enzyme coated with chitosan nanoparticles. Plant Arch., 21: 1079-1087. https://doi.org/10.51470/PLANTARCHIVES.2021.v21.S1.169

Ali SF, Hassanein R, El-Malek AM, Elsayh KI (2010). Incidence and characterization of E. coli O157: H7 isolated from minced beef, chicken meats and human stools in Assiut city. Assiut. Vet. Med. J., 56(125): 94-106. https://doi.org/10.21608/avmj.2010.173885

Allam RM, Al-Abd AM, Khedr A, Sharaf OA, Nofal SM, Khalifa AE, Mosli HA, Abdel-Naim AB (2018). Fingolimod interrupts the cross talk between estrogen metabolism and sphingolipid metabolism within prostate cancer cells. Toxicol. Lett., 11: 77-85. https://doi.org/10.1016/j.toxlet.2018.04.008

Benhabiles MS, Salah R, Lounici H, Drouiche N, Goosen MFA, Mameri N (2012). Antibacterial activity of chitin, chitosan and its oligomers prepared from shrimp shell waste. Food Hydrocoll., 29: 48-56. https://doi.org/10.1016/j.foodhyd.2012.02.013

Bhaisare DB, Richard TD, Punniamurthy CN (2012). Bacterial pathogens in chicken meat: Review. Int. J. Life Sci. Res., 2: 1-7.

Calvo P, Remunan-Lopez C, Vila-Jato JL, Alonso MJ (1997). Novel hydrophilic chitosan- polyethylene oxide nanoparticles as protein carriers. J. Appl. Polym. Sci., 63: 125–132. https://doi.org/10.1002/(SICI)1097-4628(19970103)63:1<125::AID-APP13>3.0.CO;2-4

Chandrasekaran M, Kim KD, Chun SC (2020). Antibacterial activity of chitosan nanoparticles: A review. Processes, 8: 1173. https://doi.org/10.3390/pr8091173

Chassagne L, Pradel N, Robin F, Livrelli V, Bonnet R, Delmas J (2009). Detection of stx1, stx2, and eae genes of enterohemorrhagic Escherichia coli using SYBR Green in a real-time polymerase chain reaction. Diagn. Microbiol. Infect. Dis., 64(1): 98-101. https://doi.org/10.1016/j.diagmicrobio.2009.01.031

Clinical and Laboratory Standards Institute (CLSI) (2015). Performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement. CLSI document M100-S25.

Deng QY, Zhou CR, Luo BH (2006). Preparation and characterization of chitosan nanoparticles containing lysozyme. Pharm. Biol., 44: 336-342. https://doi.org/10.1080/13880200600746246

Divya K, Vijayan S, George TK, Jisha MS (2017). Antimicrobial properties of chitosan nanoparticles: Mode of action and factors affecting activity. Fibers. Polym., 18: 221–230. https://doi.org/10.1007/s12221-017-6690-1

Dragan ES, Cocarta AI, Gierszewska M (2016). Designing novel macroporous composite hydrogels based on methacrylic acid copolymers and chitosan and in vitro assessment of lysozyme controlled delivery. Colloids. Surf. B, 139: 33–41. https://doi.org/10.1016/j.colsurfb.2015.12.011

Eldaly AE, Mahmoud FA, Abobakr HM (2018). Preservative effect of chitosan coating on shelf life and sensory properties of chicken fillets during chilled storage. Jour. Nut. Food. Sec., 3: 139-148.

El-Khawas KM, Mashat BH, Attala OA, Kassem GM (2020). Control of Salmonella and Escherichia coli in chilled chicken fillets using chitosan and lactic acid. CYTA J. Food., 18(1): 445-450. https://doi.org/10.1080/19476337.2020.1772887

Elsherif WM, Shrief LMTA (2021). Effects of three essential oils and their nano-emulsions on Listeria monocytogenes and Shigella flexneri in Egyptian Talaga cheese. Int. J. Food Micro. 355: 109334. https://doi.org/10.1016/j.ijfoodmicro.2021.109334

Khatibi SA, Misaghi A, Moosavy MH, Akhondzadeh Basti A, Mohamadian S, Khanjari A (2018). Effect of nanoliposomes containing Zataria multiflora Boiss. essential oil on gene expression of Shiga toxin 2 in Escherichia coli O157: H7. J. Appl. Microbiol., 124(2): 389-397. https://doi.org/10.1111/jam.13641

Khorshidian N, Khanniri E, Koushki MR, Sohrabvandi S, Yousefi M (2022). An overview of antimicrobial activity of lysozyme and its functionality in cheese. Front. In. Nutr., 9: 833618. https://doi.org/10.3389/fnut.2022.833618

Kijowski J, Marciszewska C, Cegielska-Radziejewska R, Popiół A (2013). Effect of lysozyme treatment on quality and bacterial contamination of chilled chicken legs. J. Vet. Res., 57: 79-84. https://doi.org/10.2478/bvip-2013-0015

Kim HY, Kim KJ, Lee JW, Kim GW, Choe JH, Kim HW, Yoon Y, Kim CJ (2015). Quality evaluation of chicken nugget formulated with various contents of chicken skin and wheat fiber mixture. Korean J. Food. Sci. Anim. Resour., 35: 19. https://doi.org/10.5851/kosfa.2015.35.1.19

Kim MY, Jung S, Kim J, Lee HJ, Jeong S, Sim SJ, Kim SK (2021). Highly sensitive and multiplexed one-step RT-qPCR for profiling genes involved in the circadian rhythm using microparticles. Sci. Rep., 11: 6463. https://doi.org/10.1038/s41598-021-85728-y

Koukaras EN, Papadimitriou SA, Bikiaris DN, Froudakis GE (2012). Insight on the formation of chitosan nanoparticles through ionotropic gelation with tripolyphosphate. Mol. Pharm., 9: 2856–2862. https://doi.org/10.1021/mp300162j

Kralik G, Kralik Z, Grčević M, Hanžek D (2018). Quality of chicken meat. Anim. Hus. Nutr. 4: 64-93. https://doi.org/10.5772/intechopen.72865

Li W, Li X, Wang Q, Pan Y, Wang T, Wang H, Song R, Deng H (2014). Antibacterial activity of nanofibrous mats coated with lysozyme-layered silicate composites via electrospraying. Carbohydr. Polym., 99: 218-225. https://doi.org/10.1016/j.carbpol.2013.07.055

Lu Y, Xie L, Chen J (2012). A novel procedure for absolute real-time quantification of gene expression patterns. Plant Methods, 8: 9. https://doi.org/10.1186/1746-4811-8-9

O’flynn G, Ross RP, Fitzgeral GF, Coffey A (2004). Evaluation of a cocktail of three bacteriophages for biocontrol of Escherichia coli O157:H7. Appl. Environ. Microbiol., 70: 3417–3424. https://doi.org/10.1128/AEM.70.6.3417-3424.2004

Pfaffl MW. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucl. Acids Res., 29: e45. https://doi.org/10.1093/nar/29.9.e45

Piras AM, Maisetta G, Sandreschi S, Esin S, Gazzarri M, Batoni G, Chiellini F (2014). Preparation, and physical–chemical and biological characterization of chitosan nanoparticles loaded with lysozyme. Int. J. Biol. Macromol., 67: 124-131. https://doi.org/10.1016/j.ijbiomac.2014.03.016

Primo ED, Otero LH, Ruiz F, Klinke S, Giordano W (2018). The disruptive effect of lysozyme on the bacterial cell wall explored by an in-silico structural outlook. Biochem. Mol. Biol. Educ., 46: 83–90. https://doi.org/10.1002/bmb.21092

Rabea EI, Badawy ME, Stevens CV, Smagghe G, Steurbaut W (2003). Chitosan as antimicrobial agent: Applications and mode of action. Biomacromolecules, 4: 1457-1465. https://doi.org/10.1021/bm034130m

Vilcacundo R, Méndez P, Reyes W, Romero H, Pinto A, Carrillo W (2018). Antibacterial activity of hen egg white lysozyme denatured by thermal and chemical treatments. Sci. Pharm., 86: 48. https://doi.org/10.3390/scipharm86040048

Wu T, Wu C, Fu S, Wang L, Yuan C, Chen S, Hu Y (2017). Integration of lysozyme into chitosan nanoparticles for improving antibacterial activity. Carbohydr. Polym., 155: 192-200. https://doi.org/10.1016/j.carbpol.2016.08.076

Yang X, Sun H, Fan R, Fu S, Zhang J, Matussek A, Xiong Y, Bai X (2020). Genetic diversity of the intimin gene (eae) in non-O157 Shiga toxin-producing Escherichia coli strains in China. Sci. Rep., 10: 3275. https://doi.org/10.1038/s41598-020-60225-w

Yilmaz AH (2020). Antibacterial activity of chitosan-based systems. functional chitosan: Drug delivery and biomedical applications, pp. 457–489. https://doi.org/10.1007/978-981-15-0263-7_15

Younes I, Sellimi S, Rinaudo M, Jellouli K, Nasri M (2014). Influence of acetylation degree and molecular weight of homogeneous chitosan on antibacterial and antifungal activities. Int. J. Food. Microbiol., 185: 57–56. https://doi.org/10.1016/j.ijfoodmicro.2014.04.029

Yuan S, Yin J, Jiang W, Liang B, Pehkonen SO, Choong C (2013). Enhancing antibacterial activity of surface-grafted chitosan with immobilized lysozyme on bioinspired stainless steel substrates. Colloids Surf., 106: 11-21. https://doi.org/10.1016/j.colsurfb.2012.12.048